Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000114853 (click for geneview)
Transcript ID ENST00000232974(link to ensembl)
Symbol NP_660149.1
Localtion Chromosome:3:42675878:42684076:1 band: 3p22.1
Description zinc finger protein 651 [Source:RefSeq_peptide;Acc:NP_660149]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-E--S--S--E--E--E--E--G--E--E--G--E--A--G--G--K--Q--G--P--R--G--S--R--S--S--R--A--D--P--P--P--H--S--
GAGAGCTCTGAGGAGGAGGAGGGGGAGGAGGGGGAGGCTGGGGGCAAGCAGGGGCCACGGGGAAGCCGAAGCAGCCGGGCAGACCCCCCTCCCCACAGTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
H--M--A--T--R--S--R--E--N--A--R--R--R--G--T--P--E--P--E--E--A--G--R--R--G--G--K--R--P--K--P--P--P--G
ACATGGCCACACGGTCCCGGGAGAACGCCCGGCGCCGGGGTACCCCTGAACCTGAAGAAGCTGGGCGGCGGGGTGGGAAGAGGCCAAAGCCACCCCCTGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--V--A--S--A--S--A--R--G--P--P--A--T--D--G--L--G--A--K--V--K--L--E--E--K--Q--H--H--P--C--Q--K--C--P-
AGTGGCCTCTGCATCGGCCCGAGGGCCGCCAGCCACTGATGGGCTGGGGGCCAAGGTGAAGCTGGAGGAGAAGCAGCACCATCCATGCCAGAAGTGCCCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-R--V--F--N--N--R--W--Y--L--E--K--H--M--N--V--T--H--S--R--M--Q--I--C--D--Q--C--G--K--R--F--L--L--E--
CGAGTTTTCAACAACCGCTGGTACCTGGAGAAACACATGAATGTGACCCACAGCCGCATGCAGATCTGCGACCAGTGCGGCAAGCGCTTCCTGCTGGAGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------><----------------------------------------------------
S--E--L--L--L--H--R--Q--T--D--C--E--R--N--I--Q--C--V--T--C--G--K--A--F--K--K--L--W--S--L--H--E--H--N
GCGAGCTGCTGCTGCACAGGCAGACAGACTGCGAGCGCAACATCCAGTGTGTGACATGTGGCAAAGCTTTCAAGAAGCTTTGGTCCCTCCATGAGCATAA
                                               :::::::::::.:::::::::::.::::::::.:::::::::::::::::.::
-----------------------------------------------TGTGTGACATGCGGCAAAGCTTTTAAGAAGCTCTGGTCCCTCCATGAGCACAA
------------------------------------------------C--V--T--C--G--K--A--F--K--K--L--W--S--L--H--E--H--N

----------------------------------------------------------------------------------------------><----
--K--I--V--H--G--Y--A--E--K--K--F--S--C--E--I--C--E--K--K--F--Y--T--M--A--H--V--R--K--H--M--V--A--H-
CAAGATTGTGCACGGCTACGCAGAGAAGAAGTTCTCATGCGAGATCTGTGAGAAGAAGTTCTACACCATGGCCCACGTGCGTAAGCACATGGTTGCCCAC
::::::::::::.:::::::::::.::::::::::: ::.:::::.::::::::::::::::::::::::::.::::::::.:::::::::         
CAAGATTGTGCATGGCTACGCAGAAAAGAAGTTCTCCTGTGAGATTTGTGAGAAGAAGTTCTACACCATGGCTCACGTGCGCAAGCACATG---------
--K--I--V--H--G--Y--A--E--K--K--F--S--C--E--I--C--E--K--K--F--Y--T--M--A--H--V--R--K--H--M----------

----------------------------------------------------------------------------------------------------
-T--K--D--M--P--F--T--C--E--T--C--G--K--S--F--K--R--S--M--S--L--K--V--H--S--L--Q--H--S--G--E--K--P--
ACCAAGGACATGCCCTTCACCTGCGAGACCTGCGGAAAGTCCTTCAAGCGCAGCATGTCCCTCAAGGTGCACTCACTGCAGCACTCAGGGGAGAAGCCGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------><----------------------------------------------------------------------------------------
F--R--C--E--N--C--N--E--R--F--Q--Y--K--Y--Q--L--R--S--H--M--S--I--H--I--G--H--K--Q--F--M--C--Q--W--C
TCAGATGTGAGAACTGCAATGAGCGCTTCCAGTACAAGTACCAGCTGCGGTCACACATGAGCATCCACATTGGCCACAAGCAGTTCATGTGCCAATGGTG
              ::::::::::::::::::::::::::::::::::::::::::::::::::::::::.:::::::::::::::::::::::.:::::
--------------TGCAATGAGCGCTTCCAGTACAAGTACCAGCTGCGGTCACACATGAGCATCCACATCGGCCACAAGCAGTTCATGTGCCAGTGGTG
---------------C--N--E--R--F--Q--Y--K--Y--Q--L--R--S--H--M--S--I--H--I--G--H--K--Q--F--M--C--Q--W--C

-------------------------------------------------------><-------------------------------------------
--G--K--D--F--N--M--K--Q--Y--F--D--E--H--M--K--T--H--T--G--E--K--P--Y--I--C--E--I--C--G--K--S--F--T-
CGGCAAGGACTTCAACATGAAGCAGTACTTCGATGAGCACATGAAGACCCACACAGGAGAGAAGCCGTACATCTGCGAGATCTGTGGCAAGAGCTTCACC
::::::::::::::::::::::::::::::.::::::::::::::::::::::::   ::::::::::::::::::::::::::.:::::::::::::::
CGGCAAGGACTTCAACATGAAGCAGTACTTTGATGAGCACATGAAGACCCACACA---GAGAAGCCGTACATCTGCGAGATCTGCGGCAAGAGCTTCACC
--G--K--D--F--N--M--K--Q--Y--F--D--E--H--M--K--T--H--T-----E--K--P--Y--I--C--E--I--C--G--K--S--F--T-

----------------------------------------------------------------------------------------------------
-S--R--P--N--M--K--R--H--R--R--T--H--T--G--E--K--P--Y--P--C--D--V--C--G--Q--R--F--R--F--S--N--M--L--
AGCCGGCCCAACATGAAGCGGCACCGGCGCACGCACACGGGCGAGAAGCCGTACCCGTGCGACGTGTGTGGCCAGCGCTTCCGCTTCTCCAACATGCTCA
:::::.::::::::::::::::::::.::::::::::: :: :::::::: ::::: :::::::::::::::::::::::::::::::::::::::::::
AGCCGACCCAACATGAAGCGGCACCGACGCACGCACACCGGGGAGAAGCCCTACCCCTGCGACGTGTGTGGCCAGCGCTTCCGCTTCTCCAACATGCTCA
-S--R--P--N--M--K--R--H--R--R--T--H--T--G--E--K--P--Y--P--C--D--V--C--G--Q--R--F--R--F--S--N--M--L--

----------------------------------------------------------------------------------------------------
K--A--H--K--E--K--C--F--R--V--S--H--T--L--A--G--D--G--V--P--A--A--P--G--L--P--P--T--Q--P--Q--A--H--A
AGGCCCACAAGGAGAAGTGCTTCCGCGTCAGCCACACCCTGGCCGGCGACGGCGTCCCCGCTGCCCCAGGCCTGCCCCCAACCCAGCCCCAGGCGCACGC
:::: :::::::::::::::::::::::::::::: ::::::::.::::.::...:::.:: :::::::: :::::.:: ::.:::::::::      ::
AGGCGCACAAGGAGAAGTGCTTCCGCGTCAGCCACCCCCTGGCCAGCGATGGTACCCCTGCGGCCCCAGGGCTGCCTCCCACTCAGCCCCAG------GC
K--A--H--K--E--K--C--F--R--V--S--H--P--L--A--S--D--G--T--P--A--A--P--G--L--P--P--T--Q--P--Q--------A

----------------------------------------------------------------------------------------------------
--L--P--L--L--P--G--L--P--Q--T--L--P--P--P--P--H--L--P--P--P--P--P--L--F--P--T--T--A--S--P--G--G--R-
ACTGCCCCTGCTCCCGGGGCTGCCCCAGACCCTGCCGCCCCCGCCCCACCTGCCGCCCCCGCCTCCGCTCTTCCCCACCACTGCCAGCCCCGGCGGGAGG
 ::::::::::: ::.::::::::::::::::. :: :::                                                            
TCTGCCCCTGCTGCCAGGGCTGCCCCAGACCCCCCCCCCC------------------------------------------------------------
--L--P--L--L--P--G--L--P--Q--T--P--P--P-------------------------------------------------------------

----------------->
-M--N--A--N--N--*-
ATGAACGCCAACAACTAG
                  
------------------
------------------

Pig Consensus Sequence

>BGISUST0000897545
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
-----------------------------------------------TGTGTGACATGCGGCAAAGCTTTTAAGAAGCTCTGGTCCCTCCATGAGCACAA
CAAGATTGTGCATGGCTACGCAGAAAAGAAGTTCTCCTGTGAGATTTGTGAGAAGAAGTTCTACACCATGGCTCACGTGCGCAAGCACATG---------
----------------------------------------------------------------------------------------------------
--------------TGCAATGAGCGCTTCCAGTACAAGTACCAGCTGCGGTCACACATGAGCATCCACATCGGCCACAAGCAGTTCATGTGCCAGTGGTG
CGGCAAGGACTTCAACATGAAGCAGTACTTTGATGAGCACATGAAGACCCACACA---GAGAAGCCGTACATCTGCGAGATCTGCGGCAAGAGCTTCACC
AGCCGACCCAACATGAAGCGGCACCGACGCACGCACACCGGGGAGAAGCCCTACCCCTGCGACGTGTGTGGCCAGCGCTTCCGCTTCTCCAACATGCTCA
AGGCGCACAAGGAGAAGTGCTTCCGCGTCAGCCACCCCCTGGCCAGCGATGGTACCCCTGCGGCCCCAGGGCTGCCTCCCACTCAGCCCCAGGCTCTGCC
CCTGCTGCCAGGGCTGCCCCAGACCCCCCCCCCC------------------------------------------------------------------
------------


>BGISUSP0000897545
----------------------------------------------------------------------------------------------------
-------------------------------------------------CVTCGKAFKKLWSLHEHNKIVHGYAEKKFSCEICEKKFYTMAHVRKHM---
--------------------------------------CNERFQYKYQLRSHMSIHIGHKQFMCQWCGKDFNMKQYFDEHMKTHT-EKPYICEICGKSFT
SRPNMKRHRRTHTGEKPYPCDVCGQRFRFSNMLKAHKEKCFRVSHPLASDGTPAAPGLPPTQPQALPLLPGLPQTPPP----------------------
----