Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000118137 (click for geneview)
Transcript ID ENST00000236850(link to ensembl)
Symbol APOA1
Localtion Chromosome:11:116211679:116213548:-1 band: 11q23.3
Description Apolipoprotein A-I precursor (Apo-AI) (ApoA-I) [Contains: Apolipoprotein A-I(1-242)]. [Source:Uniprot/SWISSPROT;Acc:P02647]
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-----------------------------------------><--------------------------------------------------------
-M--K--A--A--V--L--T--L--A--V--L--F--L--T--G--S--Q--A--R--H--F--W--Q--Q--D--E--P--P--Q--S--P--W--D--
ATGAAAGCTGCGGTGCTGACCTTGGCCGTGCTCTTCCTGACGGGGAGCCAGGCTCGGCATTTCTGGCAGCAAGATGAACCCCCCCAGAGCCCCTGGGATC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------------------------------->
R--V--K--D--L--A--T--V--Y--V--D--V--L--K--D--S--G--R--D--Y--V--S--Q--F--E--G--S--A--L--G--K--Q--L--N
GAGTGAAGGACCTGGCCACTGTGTACGTGGATGTGCTCAAAGACAGCGGCAGAGACTATGTGTCCCAGTTTGAAGGCTCCGCCTTGGGAAAACAGCTAAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

<---------------------------------------------------------------------------------------------------
--L--K--L--L--D--N--W--D--S--V--T--S--T--F--S--K--L--R--E--Q--L--G--P--V--T--Q--E--F--W--D--N--L--E-
CCTAAAGCTCCTTGACAACTGGGACAGCGTGACCTCCACCTTCAGCAAGCTGCGCGAACAGCTCGGCCCTGTGACCCAGGAGTTCTGGGATAACCTGGAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-K--E--T--E--G--L--R--Q--E--M--S--K--D--L--E--E--V--K--A--K--V--Q--P--Y--L--D--D--F--Q--K--K--W--Q--
AAGGAGACAGAGGGCCTGAGGCAGGAGATGAGCAAGGATCTGGAGGAGGTGAAGGCCAAGGTGCAGCCCTACCTGGACGACTTCCAGAAGAAGTGGCAGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
E--E--M--E--L--Y--R--Q--K--V--E--P--L--R--A--E--L--Q--E--G--A--R--Q--K--L--H--E--L--Q--E--K--L--S--P
AGGAGATGGAGCTCTACCGCCAGAAGGTGGAGCCGCTGCGCGCAGAGCTCCAAGAGGGCGCGCGCCAGAAGCTGCACGAGCTGCAAGAGAAGCTGAGCCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--L--G--E--E--M--R--D--R--A--R--A--H--V--D--A--L--R--T--H--L--A--P--Y--S--D--E--L--R--Q--R--L--A--A-
ACTGGGCGAGGAGATGCGCGACCGCGCGCGCGCCCATGTGGACGCGCTGCGCACGCATCTGGCCCCCTACAGCGACGAGCTGCGCCAGCGCTTGGCCGCG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-R--L--E--A--L--K--E--N--G--G--A--R--L--A--E--Y--H--A--K--A--T--E--H--L--S--T--L--S--E--K--A--K--P--
CGCCTTGAGGCTCTCAAGGAGAACGGCGGCGCCAGACTGGCCGAGTACCACGCCAAGGCCACCGAGCATCTGAGCACGCTCAGCGAGAAGGCCAAGCCCG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
A--L--E--D--L--R--Q--G--L--L--P--V--L--E--S--F--K--V--S--F--L--S--A--L--E--E--Y--T--K--K--L--N--T--Q
CGCTCGAGGACCTCCGCCAAGGCCTGCTGCCCGTGCTGGAGAGCTTCAAGGTCAGCTTCCTGAGCGCTCTCGAGGAGTACACTAAGAAGCTCAACACCCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--->
--*-
GTGA
    
----
----