Sequences
EST Library Info
cte2Testicle - RNA from China
sag1Salivary gland
tes9Testes
Clusters
Oligos
SNPs

Gene ID ENSG00000118434 (click for geneview)
Transcript ID ENST00000237201(link to ensembl)
Symbol SPACA1
Localtion Chromosome:6:88814226:88833269:1 band: 6q15
Description sperm acrosome associated 1 [Source:RefSeq_peptide;Acc:NP_112222]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--S--P--R--G--T--G--C--S--A--G--L--L--M--T--V--G--W--L--L--L--A--G--L--Q--S--A--R--G--T--N--V--T--
ATGAGCCCCAGGGGCACGGGCTGCTCCGCCGGGCTGCTGATGACTGTCGGCTGGCTGCTTCTGGCGGGCCTCCAGTCCGCGCGCGGGACCAACGTCACCG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
A--A--V--Q--D--A--G--L--A--H--E--G--E--G--E--E--E--T--E--N--N--D--S--E--T--A--E--N--Y--A--P--P--E--T
CTGCCGTCCAGGATGCCGGCCTGGCCCACGAAGGCGAGGGCGAGGAGGAGACCGAAAACAACGACAGCGAGACCGCGGAGAACTACGCTCCGCCTGAAAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------><-------------------------------------------------------><----------------------------------
--E--D--V--S--N--R--N--V--V--K--E--V--E--F--G--M--C--T--V--T--C--G--I--G--V--R--E--V--I--L--T-----N-
CGAGGATGTTTCAAATAGGAATGTCGTCAAAGAAGTAGAATTCGGAATGTGCACCGTTACATGTGGTATTGGTGTTAGAGAAGTTATATTAACA---AAT
          :::::::.::  :: :::::::::::::::::.::.::::::::::::::::::   .:::::.:.::::::::. ::::::     :.:
----------TCAAATAAGACGGTAGTCAAAGAAGTAGAATTTGGGATGTGCACCGTTACATGT---GTTGGTATCAGAGAAGTCTTATTAAGCA--AGT
-----------S--N--K--T--V--V--K--E--V--E--F--G--M--C--T--V--T--C-----V--G--I--R--E--V--L--L--S--\--N-

------------------------------------------------------------------------><--------------------------
-G--C--P--G-----G--E--S--K--C--V--V--R--V--E--E--C--R--G--P--T--D--C--G--W--G--K--P--I--S--E--S--L--
GGATGCCCTGGT---GGTGAATCCAAGTGTGTTGTACGGGTAGAAGAATGCCGTGGACCAACAGATTGTGGCTGGGGTAAACCAATTTCAGAAAGTCTTG
:::::::::::    :::::::::::::::.:.:::::.:::::::::::::::::::::..::::::::::   :::::::::::::::::::.:::.:
GGATGCCCTGGAT--GGTGAATCCAAGTGTATCGTACGAGTAGAAGAATGCCGTGGACCAGTAGATTGTGGC---GGTAAACCAATTTCAGAAAATCTCG
-G--C--P--G--\--G--E--S--K--C--I--V--R--V--E--E--C--R--G--P--V--D--C--G-----G--K--P--I--S--E--N--L--

-------------------------------------------------------------------------------><-------------------
E--S--V--R--L--A--C--I--H--T--S--P--L--N--R--F--K--Y--M--W--K--L--L--R--Q--D--Q--Q--S--I--I--L--V--N
AAAGTGTTAGATTGGCATGTATTCACACATCTCCCTTAAATCGTTTCAAATATATGTGGAAACTTCTAAGACAAGACCAACAATCCATTATACTTGTAAA
:::::::::::.:: :::::.::::.::::::::. ::::.::::::::::::.: ::::.:::::::::.: :.:::::::: ::.:::::::::.:::
AAAGTGTTAGACTGTCATGTGTTCATACATCTCCTGTAAACCGTTTCAAATATGTTTGGAGACTTCTAAGGCCAAACCAACAAGCCGTTATACTTGCAAA
E--S--V--R--L--S--C--V--H--T--S--P--V--N--R--F--K--Y--V--W--R--L--L--R--P--N--Q--Q--A--V--I--L--A--N

----------------------------------------------------------------------------------------------------
--D--S--A--I--L--E--V--R--K--E--S--H--P--L--A--F--E--C--D--T--L--D--N--N--E--I--V--A--T--I--K--F--T-
TGATTCAGCAATCCTAGAAGTACGCAAGGAAAGTCACCCCTTGGCTTTCGAGTGTGACACACTGGATAATAATGAAATAGTAGCAACTATTAAATTCACA
:::::::::::::::.::.:: :. :.::::: ::::::: :::::::: ::::::: :::.::::.:::::::::::::::::::::.:::::::::::
TGATTCAGCAATCCTGGAGGTTCAAAGGGAAACTCACCCCATGGCTTTCCAGTGTGAAACATTGGACAATAATGAAATAGTAGCAACTGTTAAATTCACA
--D--S--A--I--L--E--V--Q--R--E--T--H--P--M--A--F--Q--C--E--T--L--D--N--N--E--I--V--A--T--V--K--F--T-

---------------><-----------------------------------------------------------------------------------
-V--Y--T--S--S--E--L--Q--M--R--R--S--S--L--P--A--T--D--A--A--L--I--F--V--L--T--I--G--V--I--I--C--V--
GTCTATACGAGCAGTGAATTGCAGATGAGAAGATCAAGCCTACCAGCCACTGATGCAGCCCTAATTTTTGTGCTGACCATAGGAGTCATTATCTGTGTAT
::::::::.         ::::::::::.::::::::::: ::::: :::::::::::.::::.::::::::::::::::::::::.:::::::::.:::
GTCTATACA---------TTGCAGATGAAAAGATCAAGCCGACCAGACACTGATGCAGTCCTAGTTTTTGTGCTGACCATAGGAGTTATTATCTGTATAT
-V--Y--T-----------L--Q--M--K--R--S--S--R--P--D--T--D--A--V--L--V--F--V--L--T--I--G--V--I--I--C--I--

------------------------------------><--------------------------------------------------------------
F--I--I--F--L--L--I--F--I--I--I--N--W--A--A--V--K--A--F--W--G--A--K--A--S--T--P--E--V--Q--S--E--Q--S
TTATAATTTTCTTATTGATCTTCATAATCATAAATTGGGCAGCAGTCAAGGCTTTCTGGGGGGCAAAAGCCTCTACACCTGAGGTACAATCCGAGCAGAG
:..:.::.::. ::.:::::::::::::..::      ::..:::::::.: :::::::: . :::::::.:: ::: :::::.:::::::.:::: :::
TCGTGATCTTTGTACTGATCTTCATAATTGTA------GCGACAGTCAAAGATTTCTGGGCATCAAAAGCTTCAACAACTGAGATACAATCTGAGCTGAG
F--V--I--F--V--L--I--F--I--I--V--------A--T--V--K--D--F--W--A--S--K--A--S--T--T--E--I--Q--S--E--L--S

--------------------------------------------------------------------------------------------->
--S--V--R--Y--K--D--S--T--S--L--D--Q--L--P--T--E--M--P--G-----E--D--D--A--L--S--E--W--N--E--*-
TTCTGTGAGATACAAAGATTCAACTTCTCTTGACCAATTACCAACAGAAATGCCTGGT---GAAGATGATGCTTTAAGTGAATGGAATGAATGA
::: .:::..::::::::::::::::::::::::::.:.::::::::::::.:::::    :::::.:::::::::::::::::::::::::::
TTCAATGAAGTACAAAGATTCAACTTCTCTTGACCAGTCACCAACAGAAATACCTGGACATGAAGACGATGCTTTAAGTGAATGGAATGAATGA
--S--M--K--Y--K--D--S--T--S--L--D--Q--S--P--T--E--I--P--G--H--E--D--D--A--L--S--E--W--N--E--*-

Pig Consensus Sequence

>BGISUST0000879066
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------TCAAATAAGACGGTAGTCAAAGAAGTAGAATTTGGGATGTGCACCGTTACATGT---GTTGGTATCAGAGAAGTCTTATTAAGcaGTGGA
TGCCCTGGagGTGAATCCAAGTGTATCGTACGAGTAGAAGAATGCCGTGGACCAGTAGATTGTGGC---GGTAAACCAATTTCAGAAAATCTCGAAAGTG
TTAGACTGTCATGTGTTCATACATCTCCTGTAAACCGTTTCAAATATGTTTGGAGACTTCTAAGGCCAAACCAACAAGCCGTTATACTTGCAAATGATTC
AGCAATCCTGGAGGTTCAAAGGGAAACTCACCCCATGGCTTTCCAGTGTGAAACATTGGACAATAATGAAATAGTAGCAACTGTTAAATTCACAGTCTAT
ACA---------TTGCAGATGAAAAGATCAAGCCGACCAGACACTGATGCAGTCCTAGTTTTTGTGCTGACCATAGGAGTTATTATCTGTATATTCGTGA
TCTTTGTACTGATCTTCATAATTGTA------GCGACAGTCAAAGATTTCTGGGCATCAAAAGCTTCAACAACTGAGATACAATCTGAGCTGAGTTCAAT
GAAGTACAAAGATTCAACTTCTCTTGACCAGTCACCAACAGAAATACCTGGACATGAAGACGATGCTTTAAGTGAATGGAATGAA


>BGISUSP0000879066
----------------------------------------------------------------------SNKTVVKEVEFGMCTVTC-VGIREVLLSSG
CPGGESKCIVRVEECRGPVDCG-GKPISENLESVRLSCVHTSPVNRFKYVWRLLRPNQQAVILANDSAILEVQRETHPMAFQCETLDNNEIVATVKFTVY
T---LQMKRSSRPDTDAVLVFVLTIGVIICIFVIFVLIFIIV--ATVKDFWASKASTTEIQSELSSMKYKDSTSLDQSPTEIPGHEDDALSEWNE