Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000119608 (click for geneview)
Transcript ID ENST00000238583(link to ensembl)
Symbol Q9Y6T0_HUMAN
Localtion Chromosome:14:74390604:74400290:-1 band: 14q24.3
Description Similarity by BLASTN to AF063018.
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--D--P--N--S--I--L--L--S--P--Q--P--Q--I--C--S--H--L--A--E--A--C--T--E--G--E--R--S--S--S--P--P--E--
ATGGATCCAAACTCCATCTTGCTTTCTCCTCAGCCCCAGATCTGCTCCCACCTAGCAGAAGCTTGTACGGAAGGCGAGAGAAGCTCATCCCCTCCAGAGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
L--D--R--D--S--P--F--P--W--S--Q--V--P--S--S--S--P--T--D--P--E--W--F--G--D--E--H--I--Q--A--K--R--A--R
TGGATAGAGACTCCCCGTTTCCCTGGAGTCAGGTCCCCAGCTCCAGCCCTACAGACCCCGAATGGTTTGGTGATGAGCACATCCAGGCAAAGAGGGCCAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--V--E--T--I--V--R--G--M--C--L--S--P--N--P--L--V--P--G--N--A--Q--A--G--V--S--P--R--C--P--K--K--A--R-
AGTGGAGACCATTGTCCGAGGCATGTGTCTCTCCCCGAATCCTCTGGTGCCAGGCAATGCGCAAGCTGGGGTCAGCCCACGCTGCCCAAAGAAGGCCCGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-E--R--K--R--K--Q--N--L--P--T--P--Q--G--L--L--M--P--A--P--A--W--D--Q--G--N--R--K--G--G--P--R--V--R--
GAGAGGAAGAGGAAGCAGAACCTTCCCACACCGCAAGGCCTCCTGATGCCAGCCCCTGCCTGGGACCAGGGCAACAGGAAGGGGGGCCCTCGTGTGAGAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
E--Q--L--H--L--L--K--Q--Q--L--R--H--L--Q--E--H--I--L--Q--A--A--K--P--R--D--T--A--Q--G--P--G--G--C--G
AACAACTTCATCTGCTGAAGCAACAGCTAAGACATCTGCAAGAGCACATCCTACAGGCTGCCAAGCCCAGGGACACAGCTCAGGGGCCAGGAGGCTGTGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--T--G--K--G--P--L--S--A--K--Q--G--N--G--C--G--P--R--P--W--V--V--D--G--D--H--Q--Q--G--T--S--K--D--L-
CACGGGGAAAGGCCCTCTGAGTGCAAAGCAGGGGAATGGCTGTGGGCCTCGCCCCTGGGTTGTGGACGGTGACCACCAGCAAGGTACCAGCAAGGACCTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-S--G--A--E--K--H--Q--E--S--E--K--P--S--F--L--P--S--G--A--P--A--S--L--E--I--L--R--K--E--L--T--R--A--
TCTGGGGCAGAAAAACACCAAGAGTCTGAGAAGCCCAGTTTCCTTCCTTCTGGAGCACCAGCTTCACTAGAGATTCTGAGGAAAGAGCTGACCAGGGCAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------><-------------------------------------------------------------------
V--S--Q--A--V--D--S--V--L--Q--K--F--N--R--C--I--T--S--Q--M--I--K--W--F--S--N--F--R--E--F--Y--Y--I--Q
TGTCCCAGGCTGTGGACTCGGTATTACAAAAGTTCAACCGCTGCATTACCTCCCAGATGATCAAGTGGTTCAGCAACTTTCGTGAGTTTTATTACATCCA
                                :::::::::::::::::.:::::::::::::::::::::::::::::.::::::::::::::.:::::
--------------------------------TTCAACCGCTGCATTACTTCCCAGATGATCAAGTGGTTCAGCAACTTCCGTGAGTTTTATTATATCCA
---------------------------------F--N--R--C--I--T--S--Q--M--I--K--W--F--S--N--F--R--E--F--Y--Y--I--Q

----------------------------------------------------------------------------------------------------
--M--E--K--S--A--R--Q--A--I--S--D--G--V--T--N--P--K--M--L--V--V--L--R--N--S--E--L--F--Q--A--L--N--M-
AATGGAAAAATCTGCCCGGCAAGCAATTTCAGATGGTGTCACAAATCCCAAAATGCTGGTGGTTCTCCGCAATTCAGAACTTTTTCAAGCTCTCAATATG
::::::.::::.::::::::::::::::::::: :::::::: :::::::::::::::::::::::::::.:.:: ::::::::::.:::::::::.:::
AATGGAGAAATTTGCCCGGCAAGCAATTTCAGAGGGTGTCACCAATCCCAAAATGCTGGTGGTTCTCCGCGACTCTGAACTTTTTCGAGCTCTCAACATG
--M--E--K--F--A--R--Q--A--I--S--E--G--V--T--N--P--K--M--L--V--V--L--R--D--S--E--L--F--R--A--L--N--M-

--------------------------><------------------------------------------------------------------------
-H--Y--N--K--G--N--D--F--E--I--S--A--D--H--F--S--K--L--K--T--N--F--M--Q--D--L--S--V--A--V--Y--S--H--
CACTACAACAAGGGAAATGACTTTGAGATTTCTGCTGATCATTTCAGCAAACTCAAGACAAACTTTATGCAGGACTTGAGTGTTGCTGTTTATTCACATT
:::::::::::::::::::::::::::                                                                         
CACTACAACAAGGGAAATGACTTTGAG-------------------------------------------------------------------------
-H--Y--N--K--G--N--D--F--E--------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
L--S--A--G--R--V--Y--Q--L--D--N--A--N--S--L--Q--L--T--I--A--I--G--A--P--T--S--Y--M--Q--K--K--L--N--F
TGTCTGCTGGAAGAGTTTATCAGCTGGATAATGCAAATAGTCTCCAGCTGACCATTGCAATTGGTGCCCCAACCTCATATATGCAGAAGAAGCTGAACTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------->
--R--L--*-
CAGACTGTGA
          
----------
----------

Pig Consensus Sequence

>BGISUST0000880422
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
--------------------------------TTCAACCGCTGCATTACTTCCCAGATGATCAAGTGGTTCAGCAACTTCCGTGAGTTTTATTATATCCA
AATGGAGAAATTTGCCCGGCAAGCAATTTCAGAGGGTGTCACCAATCCCAAAATGCTGGTGGTTCTCCGCGACTCTGAACTTTTTCGAGCTCTCAACATG
CACTACAACAAGGGAAATGACTTTGAG-------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------


>BGISUSP0000880422
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
--------------------------------------------FNRCITSQMIKWFSNFREFYYIQMEKFARQAISEGVTNPKMLVVLRDSELFRALNM
HYNKGNDFE-------------------------------------------------------------