Sequences
EST Library Info
fce1Foetus 100 days, cerebellum
Clusters
Oligos
SNPs

Gene ID ENSG00000119722 (click for geneview)
Transcript ID ENST00000238708(link to ensembl)
Localtion Chromosome:14:76504779:76505242:1 band: 14q24.3
Description  
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--A--S--I--S-----E--L--A--C--I--Y--S--A--L--I--L--H--D--N--E--V--T--V--T--E--Y--K--I--K--A--L--I--
ATGGCCTCCATCTCC---GAGCTCGCCTGCATCTACTCAGCCCTCATTCTGCACGACAATGAGGTGACTGTCACAGAGTATAAGATCAAGGCCCTCATTA
:::::.:::.::::    :::::::::::::::::::: :::::::::::::::                                              
ATGGCTTCCGTCTCGT--GAGCTCGCCTGCATCTACTCTGCCCTCATTCTGCAC----------------------------------------------
-M--A--S--V--S--\--E--L--A--C--I--Y--S--A--L--I--L--H-----------------------------------------------

----------------------------------------------------------------------------------------------------
K--A--A--G--V--N--V--E--P--F--R--P--G--L--F--A--K--A--P--A--N--V--N--I--R--S--L--I--C--N--V--G--A--G
AAGCAGCTGGTGTAAATGTTGAACCTTTTCGGCCTGGCTTGTTTGCAAAGGCCCCGGCCAATGTCAACATTAGGAGCCTCATCTGCAATGTAGGGGCTGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------><-------------------------------------------------------------------------------
--G--P--A--P--A--A--G--V--R--P--F--L--P--W--L--P--T--S--T--A--A--A--P--A--E--E--K--K--M--E--A--K--K-
AGGACCTGCTCCAGCAGCTGGCGTACGCCCATTTCTGCCTTGGTTGCCCACCTCCACTGCTGCTGCTCCAGCTGAGGAGAAGAAAATGGAAGCAAAGAAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------->
-E--E--F--E--D--S--D--D--D--M--G--F--G--L--S--D--*-
GAAGAATTTGAGGACTCTGATGATGACATGGGCTTTGGTCTTTCTGACTAA
                                                   
---------------------------------------------------
---------------------------------------------------

Pig Consensus Sequence

>BGISUST0000880872
ATGGCTTCCGTCTCggAGCTCGCCTGCATCTACTCTGCCCTCATTCTGCAC-------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
------------------------------------------------


>BGISUSP0000880872
MASVSELACIYSALILH-----------------------------------------------------------------------------------
----------------