Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000120550 (click for geneview)
Transcript ID ENST00000239725(link to ensembl)
Symbol XP_291763.4
Localtion Chromosome:10:38408990:38409775:-1 band: 10p11.21
Description PREDICTED: similar to bA508N22.1 (HSPC025)
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-I--Y--S--R--V--P--E--C--Q--V--T--T--Y--Y--Y--V--G--F--A--Y--L--M--M--C--H--Y--Q--D--A--I--R--V--F--
ATATATTCCCGTGTGCCAGAGTGCCAGGTCACCACATACTATTATGTTGGGTTTGCATATTTGATGATGTGTCACTACCAGGATGCCATCCGGGTCTTTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
A--N--I--L--L--Y--I--Q--R--T--K--S--M--F--Q--R--T--T--Y--K--Y--E--M--I--N--K--Q--N--E--Q--M--H--A--L
CCAACATCCTCCTCTACATCCAGAGGACCAAGAGCATGTTCCAGAGGACCACATACAAGTATGAGATGATTAACAAGCAGAATGAGCAGATGCATGCACT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--L--A--I--A--L--T--M--Y--P--M--S--I--D--E--S--I--H--L--Q--R--W--D--K--Y--S--N--K--M--L--C--M--Q--K-
GCTGGCCATTGCCCTCACGATGTACCCCATGAGTATTGATGAGAGCATTCACCTCCAGCGGTGGGATAAATACAGCAACAAGATGCTGTGCATGCAGAAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-G--D--P--E--V--Y--E--E--L--F--S--Y--F--C--P--K--F--L--S--P--V--V--P--N--Y--D--N--V--H--P--N--Y--H--
GGTGACCCAGAAGTCTATGAAGAACTTTTCAGTTACTTCTGCCCCAAGTTCCTGTCGCCTGTAGTGCCCAACTACGATAATGTGCACCCCAACTACCACA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
K--E--P--F--L--Q--Q--P--K--V--F--S--D--E--V--Q--Q--Q--A--Q--L--S--T--I--R--S--F--L--K--L--Y--T--T--M
AAGAGCCCTTCCTGCAGCAGCCGAAGGTGTTTTCTGATGAAGTACAGCAGCAGGCCCAGCTTTCAACCATCCGCAGCTTCCTCAAGCTCTACACCACCAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--P--V--A--K--L--A--G--F--L--D--L--T--E--Q--E--F--R--I--Q--L--P--V--F--K--H--K--L--K--N--L--V--W--T-
GCCTGTGGCCAAGCTGGCTGGCTTCCTGGACCTCACAGAGCAGGAGTTCAGGATCCAGCTTCCTGTCTTCAAACACAAATTGAAGAACCTGGTGTGGACC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-S--S--I--T--T--L--D--D--E--F--Q--S--A--S--E--V--D--F--Y--I--D--K--D--M--I--H--I--M--D--T--K--V--A--
AGCAGCATCACAACCCTGGATGATGAATTTCAGTCAGCCTCAGAGGTTGACTTCTACATTGATAAGGACATGATCCACATCATGGACACCAAGGTCGCCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------------------------------->
R--R--Y--G--N--F--F--I--R--Q--I--H--R--F--E--E--L--N--R--T--L--K--K--M--G--Q--R--P--*-
GGCGCTATGGGAATTTCTTCATCCGTCAGATCCACAGATTCGAGGAGCTTAATCGAACCCTGAAGAAGATGGGACAGAGACCCTGA
                                                                                      
--------------------------------------------------------------------------------------
--------------------------------------------------------------------------------------