Sequences
EST Library Info
pigca4Unavailable
Clusters
Oligos
SNPs

Gene ID ENSG00000122042 (click for geneview)
Transcript ID ENST00000241470(link to ensembl)
Symbol UBL3
Localtion Chromosome:13:29236546:29322263:-1 band: 13q12.3
Description Ubiquitin-like protein 3 (HCG-1 protein). [Source:Uniprot/SWISSPROT;Acc:O95164]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-------------------------><------------------------------------------------------------------------
-M--S--S--N--V--P--A--D--M--I--N--L--R--L--I--L--V--S--G--K--T--K--E--F--L--F--S--P--N--D--S--A--S--
ATGTCCAGTAATGTCCCGGCGGATATGATAAATTTGCGCCTCATTTTGGTAAGCGGAAAAACAAAAGAGTTCCTGTTTTCTCCTAACGATTCTGCTTCTG
                           :::::::::::::::::.:::::::::::.::.:::::::::::::::::::::::.::.:::::::::::::
---------------------------ATAAATTTGCGCCTCATCTTGGTAAGCGGGAAGACAAAAGAGTTCCTGTTTTCTCCCAATGATTCTGCTTCTG
----------------------------I--N--L--R--L--I--L--V--S--G--K--T--K--E--F--L--F--S--P--N--D--S--A--S--

-----------------------------------><---------------------------------------------------------------
D--I--A--K--H--V--Y--D--N--W--P--M--D--W--E--E--E--Q--V--S--S--P--N--I--L--R--L--I--Y--Q--G--R--F--L
ACATTGCAAAGCATGTATATGACAATTGGCCAATGGACTGGGAAGAAGAGCAGGTCAGCAGTCCAAATATTCTACGACTTATTTATCAAGGACGATTTCT
::::.:::::::::::.::::::::.:::::.:::   :::::::::::::::::::::::.:::::::::::.:: :::::::::::::::::::::::
ACATCGCAAAGCATGTGTATGACAACTGGCCGATG---TGGGAAGAAGAGCAGGTCAGCAGCCCAAATATTCTGCGCCTTATTTATCAAGGACGATTTCT
D--I--A--K--H--V--Y--D--N--W--P--M-----W--E--E--E--Q--V--S--S--P--N--I--L--R--L--I--Y--Q--G--R--F--L

----------------------><----------------------------------------------------------------------------
--H--G--N--V--T--L--G--A--L--K--L--P--F--G--K--T--T--V--M--H--L--V--A--R--E--T--L--P--E--P--N--S--Q-
ACATGGAAATGTCACATTAGGAGCATTAAAACTTCCTTTTGGCAAAACAACAGTGATGCATTTGGTGGCCAGAGAGACATTACCAGAGCCAAACTCTCAA
::::::::::::::::::::::   ::.::::: :::::::::::::::::::::::::::::::: ::::::::::::::.::::::::::::::.:::
ACATGGAAATGTCACATTAGGA---TTGAAACTGCCTTTTGGCAAAACAACAGTGATGCATTTGGTCGCCAGAGAGACATTGCCAGAGCCAAACTCCCAA
--H--G--N--V--T--L--G-----L--K--L--P--F--G--K--T--T--V--M--H--L--V--A--R--E--T--L--P--E--P--N--S--Q-

><--------------------------------------------------->
-G--Q--R--N--R--E--K--T--G--E--S--N--C--C--V--I--L--*-
GGTCAGAGGAATCGTGAGAAGACTGGAGAGAGTAATTGTTGTGTAATCCTGTAA
                                                      
------------------------------------------------------
------------------------------------------------------

Pig Consensus Sequence

>BGISUST0000878749
---------------------------ATAAATTTGCGCCTCATCTTGGTAAGCGGGAAGACAAAAGAGTTCCTGTTTTCTCCCAATGATTCTGCTTCTG
ACATCGCAAAGCATGTGTATGACAACTGGCCGATG---TGGGAAGAAGAGCAGGTCAGCAGCCCAAATATTCTGCGCCTTATTTATCAAGGACGATTTCT
ACATGGAAATGTCACATTAGGA---TTGAAACTGCCTTTTGGCAAAACAACAGTGATGCATTTGGTCGCCAGAGAGACATTGCCAGAGCCAAACTCCCAA
------------------------------------------------------


>BGISUSP0000878749
---------INLRLILVSGKTKEFLFSPNDSASDIAKHVYDNWPM-WEEEQVSSPNILRLIYQGRFLHGNVTLG-LKLPFGKTTVMHLVARETLPEPNSQ
------------------