Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000124391 (click for geneview)
Transcript ID ENST00000244241(link to ensembl)
Symbol IL17C
Localtion Chromosome:16:87232502:87234031:1 band: 16q24.3
Description Interleukin-17C precursor (IL-17C) (Cytokine CX2). [Source:Uniprot/SWISSPROT;Acc:Q9P0M4]
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-Q--L--L--P--G--L--L--F--L--T--W--L--H--T--C--L--A--H--H--D--P--S--L--R--G--H--P--H--S--H--G--T--P--
CAGCTCCTCCCCGGCCTCCTGTTTCTGACCTGGCTGCACACATGCCTGGCCCACCATGACCCCTCCCTCAGGGGGCACCCCCACAGTCACGGTACCCCAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
H--C--Y--S--A--E--E--L--P--L--G--Q--A--P--P--H--L--L--A--R--G--A--K--W--G--Q--A--L--P--V--A--L--V--S
ACTGCTACTCGGCTGAGGAACTGCCCCTCGGCCAGGCCCCCCCACACCTGCTGGCTCGAGGTGCCAAGTGGGGGCAGGCTTTGCCTGTAGCCCTGGTGTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--S--L--E--A--A--S--H--R--G--R--H--E--R--P--S--A--T--T--Q--C--P--V--L--R--P--E--E--V--L--E--A--D--T-
CAGCCTGGAGGCAGCAAGCCACAGGGGGAGGCACGAGAGGCCCTCAGCTACGACCCAGTGCCCGGTGCTGCGGCCGGAGGAGGTGTTGGAGGCAGACACC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------><-------------------------------------------------------------------
-H--Q--R--S--I--S--P--W--R--Y--R--V--D--T--D--E--D--R--Y--P--Q--K--L--A--F--A--E--C--L--C--R--G--C--
CACCAGCGCTCCATCTCACCCTGGAGATACCGTGTGGACACGGATGAGGACCGCTATCCACAGAAGCTGGCCTTCGCCGAGTGCCTGTGCAGAGGCTGTA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
I--D--A--R--T--G--R--E--T--A--A--L--N--S--V--R--L--L--Q--S--L--L--V--L--R--R--R--P--C--S--R--D--G--S
TCGATGCACGGACGGGCCGCGAGACAGCTGCGCTCAACTCCGTGCGGCTGCTCCAGAGCCTGCTGGTGCTGCGCCGCCGGCCCTGCTCCCGCGACGGCTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------------------------------------>
--G--L--P--T--P--G--A--F--A--F--H--T--E--F--I--H--V--P--V--G--C--T--C--V--L--P--R--S--V--*-
GGGGCTCCCCACACCTGGGGCCTTTGCCTTCCACACCGAGTTCATCCACGTCCCCGTCGGCTGCACCTGCGTGCTGCCCCGTTCAGTGTGA
                                                                                           
-------------------------------------------------------------------------------------------
-------------------------------------------------------------------------------------------