Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000096157 (click for geneview)
Transcript ID ENST00000244389(link to ensembl)
Localtion Chromosome:6:31665031:31668741:-1 band: 6p21.33
Description  
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-----------------------------------------><--------------------------------------------------------
-M--A--W--M--L--L--L--I--L--I--M--V--H--P--G--S--C--A--L--W--V--S--Q--P--P--E--I--R--T--L--E--G--S--
ATGGCCTGGATGCTGTTGCTCATCTTGATCATGGTCCATCCAGGATCCTGTGCTCTCTGGGTGTCCCAGCCCCCTGAGATTCGTACCCTGGAAGGATCCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
S--A--F--L--P--C--S--F--N--A--S--Q--G--R--L--A--I--G--S--V--T--W--F--R--D--E--V--V--P--G--K--E--V--R
CTGCCTTCCTGCCCTGCTCCTTCAATGCCAGCCAAGGGAGACTGGCCATTGGCTCCGTCACGTGGTTCCGAGATGAGGTGGTTCCAGGGAAGGAGGTGAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--N--G--T--P--E--F--R--G--R--L--A--P--L--A--S--S--R--F--L--H--D--H--Q--A--E--L--H--I--R--D--V--R--G-
GAATGGAACCCCAGAGTTCAGGGGCCGCCTGGCCCCACTTGCTTCTTCCCGTTTCCTCCATGACCACCAGGCTGAGCTGCACATCCGGGACGTGCGAGGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------------------------------------------><-----------
-H--D--A--S--I--Y--V--C--R--V--E--V--L--G--L--G--V--G--T--G--N--G--T--R--L--V--V--E--K--E--H--P--Q--
CATGACGCCAGCATCTACGTGTGCAGAGTGGAGGTGCTGGGCCTTGGTGTCGGGACAGGGAATGGGACTCGGCTGGTGGTGGAGAAAGAACATCCTCAGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------------------------------------------------------><---
L--G--A--G--T--V--L--L--L--R--A--G--F--Y--A--V--S--F--L--S--V--A--V--G--S--T--V--Y--Y--Q--G--K--C--H
TAGGGGCTGGTACAGTCCTCCTCCTTCGGGCTGGATTCTATGCTGTCAGCTTTCTCTCTGTGGCCGTGGGCAGCACCGTCTATTACCAGGGCAAATGCCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------------------>
--C--H--M--G--T--H--C--H--S--S--D--G--P--R--G--V--I--P--E--P--R--C--P--*-
CTGTCACATGGGAACACACTGCCACTCCTCAGATGGGCCCCGAGGAGTGATTCCAGAGCCCAGATGTCCCTAG
                                                                         
-------------------------------------------------------------------------
-------------------------------------------------------------------------