Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000124649 (click for geneview)
Transcript ID ENST00000244615(link to ensembl)
Symbol LY6G5B
Localtion Chromosome:6:31746707:31748043:1 band: 6p21.33
Description lymphocyte antigen 6 complex G5B [Source:RefSeq_peptide;Acc:NP_067044]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<--------------------------------------------------------><-----------------------------------------
-M--K--V--H--M--L--V--G--V--L--V--M--V--G--F--T--V--G--K--V--P--V--P--D--I--R--T--C--H--F--C--L--V--
ATGAAGGTCCATATGCTTGTAGGTGTGCTGGTCATGGTGGGCTTCACAGTAGGAAAGGTTCCTGTTCCCGACATCCGGACGTGCCACTTCTGCCTCGTAG
                                                            ::::::::.:: .::::::: :::::..:::::::: :::
------------------------------------------------------------CCTGTTCCTGAAGTCCGGACCTGCCATCTCTGCCTCTTAG
-------------------------------------------------------------P--V--P--E--V--R--T--C--H--L--C--L--L--

--------------------------------------------------------------------------------------><------------
E--D--P--S--V--G--C--I--S--G--S--E--K--C--T--I--S--S--S--S--L--C--M--V--I--T--I--Y--Y--D--V--K--V--R
AAGACCCTTCTGTAGGATGCATTTCAGGCTCAGAGAAGTGTACCATCAGCAGCTCATCCCTGTGCATGGTGATCACCATCTATTATGATGTCAAGGTTCG
:::::::::. :::::::::::.::::::::.::::::::.::..::::::::::.::::. ::::::::::::::::::::::::              
AAGACCCTTTGGTAGGATGCATCTCAGGCTCGGAGAAGTGCACTGTCAGCAGCTCGTCCCCCTGCATGGTGATCACCATCTATTAT--------------
E--D--P--L--V--G--C--I--S--G--S--E--K--C--T--V--S--S--S--S--P--C--M--V--I--T--I--Y--Y---------------

----------------------------------------------------------------------------------------------------
--F--I--V--R--G--C--G--Q--Y--I--S--Y--R--C--Q--E--K--R--N--T--Y--F--A--E--Y--W--Y--Q--A--Q--C--C--Q-
CTTCATCGTTCGAGGCTGTGGACAGTACATTTCCTACCGCTGCCAAGAAAAACGCAACACCTACTTTGCAGAGTACTGGTATCAGGCCCAGTGCTGTCAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-Y--D--Y--C--N--S--W--S--S--P--Q--L--Q--S--S--L--P--E--P--H--D--R--P--L--A--L--P--L--S--D--S--Q--I--
TACGATTATTGCAACTCCTGGTCAAGCCCCCAACTCCAGAGCTCTCTGCCGGAGCCCCATGACAGGCCCCTGGCCCTGCCTCTGTCTGACTCCCAGATTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
Q--W--F--Y--Q--A--L--N--L--S--L--P--L--P--N--F--H--A--G--T--E--P--D--G--L--D--P--M--V--T--L--S--L--N
AGTGGTTCTACCAGGCCCTGAACCTCTCCCTGCCCCTCCCCAATTTCCATGCTGGGACGGAGCCTGATGGCCTGGACCCCATGGTCACACTGTCCCTGAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--L--G--L--S--F--A--E--L--R--R--M--Y--L--F--L--N--S--S--G--L--L--V--L--P--Q--A--G--L--L--T--P--H--P-
CCTGGGCTTGTCTTTTGCTGAGCTGCGCCGCATGTACTTGTTCCTCAATAGTTCAGGACTTTTGGTTCTTCCCCAGGCTGGACTCTTGACACCTCACCCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----->
-S--*-
TCCTGA
      
------
------

Pig Consensus Sequence

>BGISUST0000887994
------------------------------------------------------------CCTGTTCCTGAAGTCCGGACCTGCCATCTCTGCCTCTTAG
AAGACCCTTTGGTAGGATGCATCTCAGGCTCGGAGAAGTGCACTGTCAGCAGCTCGTCCCCCTGCATGGTGATCACCATCTATTAT--------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
------


>BGISUSP0000887994
--------------------PVPEVRTCHLCLLEDPLVGCISGSEKCTVSSSSPCMVITIYY--------------------------------------
----------------------------------------------------------------------------------------------------
--