Sequences
EST Library Info
cbr8Brain - RNA from China
eep1Foetus 50 days, epidermis
eye1Foetus 50 days, Eye
hea1Heart
isp1M. Infraspinatus
med1Mediastinum
nep1Newborn 115 days, epidermis
pfco4Unavailable
pliv1Unavailable
rec1Rectum
relu1Unavailable
ret1Retina
ski1Skin
sme1M. Semimembranosus
tes2Testes
uio2Unavailable
Clusters
Oligos
SNPs

Gene ID ENSG00000128989 (click for geneview)
Transcript ID ENST00000249822(link to ensembl)
Symbol ARP19_HUMAN
Localtion Chromosome:15:50626535:50648656:-1 band: 15q21.2
Description cAMP-regulated phosphoprotein 19 (ARPP-19) [Contains: cAMP-regulated phosphoprotein 16 (ARPP-16)].
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<------------------------------------------------><-------------------------------------------------
-R--K--K--G--S--V--W--T--T--A--S--G--R--S--G--V--K--G--S--T--M--S--A--E--V--P--E--A--A--S--A--E--E--
AGGAAAAAAGGAAGTGTTTGGACGACAGCGAGCGGGAGAAGCGGGGTCAAAGGGAGCACTATGTCTGCGGAAGTCCCCGAGGCAGCCTCCGCGGAGGAGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----><----------------------------------------------------------------------------------------------
Q--K--E--M--E--D--K--V--T--S--P--E--K--A--E--E--A--K--L--K--A--R--Y--P--H--L--G--Q--K--P--G--G--S--D
AGAAGGAAATGGAAGATAAAGTGACTAGTCCAGAGAAAGCAGAAGAAGCAAAATTAAAAGCAAGATATCCTCATCTGGGACAAAAGCCTGGAGGTTCAGA
     ::::::::::::::::::::::::::::::::::: ::::::::::::::::::::.::.:::::::::::::::::::::::::::::::::::
-----GAAATGGAAGATAAAGTGACTAGTCCAGAGAAAGCTGAAGAAGCAAAATTAAAAGCGAGGTATCCTCATCTGGGACAAAAGCCTGGAGGTTCAGA
------E--M--E--D--K--V--T--S--P--E--K--A--E--E--A--K--L--K--A--R--Y--P--H--L--G--Q--K--P--G--G--S--D

---------------------------><-----------------------------------------------------------------------
--F--L--R--K--R--L--Q--K--G--Q--K--Y--F--D--S--G--D--Y--N--M--A--K--A--K--M--K--N--K--Q--L--P--T--A-
TTTCTTAAGGAAACGGTTGCAGAAAGGGCAAAAATATTTTGATTCTGGGGATTACAACATGGCTAAAGCAAAAATGAAGAACAAGCAACTTCCTACTGCA
:::::::::.:::::.::::::::::::::::::::::::::::::::::::::.:::::::::::::::::::::::::::::::::::::::::::::
TTTCTTAAGAAAACGATTGCAGAAAGGGCAAAAATATTTTGATTCTGGGGATTATAACATGGCTAAAGCAAAAATGAAGAACAAGCAACTTCCTACTGCA
--F--L--R--K--R--L--Q--K--G--Q--K--Y--F--D--S--G--D--Y--N--M--A--K--A--K--M--K--N--K--Q--L--P--T--A-

-------------------------------------------------------------------------------------------------->
-A--P--D--K--T--E--V--T--G--D--H--I--P--T--P--Q--D--L--P--Q--R--K--P--S--L--V--A--S--K--L--A--G--*-
GCTCCGGATAAGACGGAGGTCACTGGTGACCACATTCCCACTCCGCAAGACCTTCCTCAACGGAAGCCGTCCCTTGTTGCTAGCAAGCTGGCTGGCTGA
::.:::::::::::.:::::::::::::::::::::::::::::.::.:::::::::::.:::::.::.::.:::::::::::::::::.:::::::::
GCCCCGGATAAGACAGAGGTCACTGGTGACCACATTCCCACTCCACAGGACCTTCCTCAGCGGAAACCATCTCTTGTTGCTAGCAAGCTAGCTGGCTGA
-A--P--D--K--T--E--V--T--G--D--H--I--P--T--P--Q--D--L--P--Q--R--K--P--S--L--V--A--S--K--L--A--G--*-

Pig Consensus Sequence

>BGISUST0000899400
----------------------------------------------------------------------------------------------------
-----GAAATGGAAGATAAAGTGACTAGTCCAGAGAAAGCTGAAGAAGCAAAATTAAAAGCGAGGTATCCTCATCTGGGACAAAAGCCTGGAGGTTCAGA
TTTCTTAAGAAAACGATTGCAGAAAGGGCAAAAATATTTTGATTCTGGGGATTATAACATGGCTAAAGCAAAAATGAAGAACAAGCAACTTCCTACTGCA
GCCCCGGATAAGACAGAGGTCACTGGTGACCACATTCCCACTCCACAGGACCTTCCTCAGCGGAAACCATCTCTTGTTGCTAGCAAGCTAGCTGGCTGA


>BGISUSP0000899400
-----------------------------------EMEDKVTSPEKAEEAKLKARYPHLGQKPGGSDFLRKRLQKGQKYFDSGDYNMAKAKMKNKQLPTA
APDKTEVTGDHIPTPQDLPQRKPSLVASKLAG*