Sequences
CT122305reads
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000129214 (click for geneview)
Transcript ID ENST00000250080(link to ensembl)
Symbol SHBG
Localtion Chromosome:17:7474216:7477395:1 band: 17p13.1
Description Sex hormone-binding globulin precursor (SHBG) (Sex steroid-binding protein) (SBP) (Testis-specific androgen-binding protein) (ABP) (Testosterone-estrogen binding globulin) (Testosterone-estradiol binding globulin) (TeBG). [Source:Uniprot/SWISSPROT;Acc:P04278]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--E--S--R--G--P--L--A--T--S--R--L--L--L--L--L--L--L--L--L--L--R--H--T--R--Q--G--W--A--L--R--P--V--
ATGGAGAGCAGAGGCCCACTGGCTACCTCGCGCCTGCTGCTGTTGCTGCTGTTGCTACTACTGCGTCACACCCGCCAGGGATGGGCCCTGAGACCTGTTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------><----------------------------------------------------------------------------------------
L--P--T--Q--S--A--H--D--P--P--A--V--H--L--S--N--G--P--G--Q--E--P--I--A--V--M--T--F--D--L--T--K--I--T
TCCCCACCCAGAGTGCCCACGACCCTCCGGCTGTCCACCTCAGCAATGGCCCAGGACAAGAGCCTATCGCTGTCATGACCTTTGACCTCACCAAGATCAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--><------------------------------------------------------------------------------------------------
--K--T--S--S--S--F--E--V--R--T--W--D--P--E--G--V--I--F--Y--G--D--T--N--P--K--D--D--W--F--M--L--G--L-
AAAAACCTCCTCCTCCTTTGAGGTTCGAACCTGGGACCCAGAGGGAGTGATTTTTTATGGGGATACCAACCCTAAGGATGACTGGTTTATGCTGGGACTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------------------------><------
-R--D--G--R--P--E--I--Q--L--H--N--H--W--A--Q--L--T--V--G--A--G--P--R--L--D--D--G--R--W--H--Q--V--E--
CGAGACGGCAGGCCTGAGATCCAACTGCACAATCACTGGGCCCAGCTTACGGTGGGTGCTGGACCACGGCTGGATGATGGGAGATGGCACCAGGTGGAAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
V--K--M--E--G--D--S--V--L--L--E--V--D--G--E--E--V--L--R--L--R--Q--V--S--G--P--L--T--S--K--R--H--P--I
TCAAGATGGAGGGGGACTCTGTGCTGCTGGAGGTGGATGGGGAGGAGGTGCTGCGCCTGAGACAGGTCTCTGGGCCCCTGACCAGCAAACGCCATCCCAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------><--------------------------------------------
--M--R--I--A--L--G--G--L--L--F--P--A--S--N--L--R--L--P--L--V--P--A--L--D--G--C--L--R--R--D--S--W--L-
CATGAGGATTGCGCTTGGGGGGCTGCTCTTCCCCGCTTCCAACCTTCGGTTGCCGCTGGTTCCTGCCCTGGATGGCTGCCTGCGCCGGGATTCCTGGCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-D--K--Q--A--E--I--S--A--S--A--P--T--S--L--R--S--C--D--V--E--S--N--P--G--I--F--L--P--P--G--T--Q--A--
GACAAACAGGCCGAGATCTCAGCATCTGCCCCCACTAGCCTCAGAAGCTGTGATGTAGAATCAAATCCCGGGATATTTCTCCCTCCAGGGACTCAGGCAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------><------------------------------------------------------------------------------------
E--F--N--L--R--D--I--P--Q--P--H--A--E--P--W--A--F--S--L--D--L--G--L--K--Q--A--A--G--S--G--H--L--L--A
AATTCAATCTCCGAGACATTCCCCAGCCTCATGCAGAGCCCTGGGCCTTCTCTTTGGACCTGGGACTCAAGCAGGCAGCAGGCTCAGGCCACCTCCTTGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------><-----------------------------------------------
--L--G--T--P--E--N--P--S--W--L--S--L--H--L--Q--D--Q--K--V--V--L--S--S--G--S--G--P--G--L--D--L--P--L-
TCTTGGGACACCAGAGAACCCATCTTGGCTCAGTCTCCACCTCCAAGATCAAAAGGTGGTGTTGTCTTCTGGGTCGGGGCCAGGGCTGGATCTGCCCCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-V--L--G--L--P--L--Q--L--K--L--S--M--S--R--V--V--L--S--Q--G--S--K--M--K--A--L--A--L--P--P--L--G--L--
GTCTTGGGACTCCCTCTTCAGCTGAAGCTGAGTATGTCCAGGGTGGTCTTGAGCCAAGGGTCGAAGATGAAGGCCCTTGCCCTGCCTCCCTTAGGCCTGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------------------><---------------------------------------
A--P--L--L--N--L--W--A--K--P--Q--G--R--L--F--L--G--A--L--P--G--E--D--S--S--T--S--F--C--L--N--G--L--W
CTCCCCTCCTTAACCTCTGGGCCAAGCCTCAAGGGCGTCTCTTCCTGGGGGCTTTACCAGGAGAAGACTCTTCCACCTCTTTTTGCCTGAATGGCCTTTG
                                                                                ::::::.::.::        
--------------------------------------------------------------------------------TTTTGCTTGGAT--------
---------------------------------------------------------------------------------F--C--L--D---------

----------------------------------------------------------------------------------------------------
--A--Q--G--Q--R--L--D--V--D--Q--A--L--N--R--S--H--E--I--W--T--H--S--C--P--Q--S--P--G--N--G--T--D--A-
GGCACAAGGTCAGAGGCTGGATGTGGACCAGGCCCTGAACAGAAGCCATGAGATCTGGACTCACAGCTGCCCCCAGAGCCCAGGCAATGGCACTGACGCT
       ::.:::::::::::..::::::.::::::::.:::::::.: :: ::..:::::::::::::.::.::::::::::::::::::::::::.:.
-------GGCCAGAGGCTGGACATGGACCGGGCCCTGAGCAGAAGCTAGGACATTCGGACTCACAGCTGTCCTCAGAGCCCAGGCAATGGCACTGACACC
--------G--Q--R--L--D--M--D--R--A--L--S--R--S--*--D--I--R--T--H--S--C--P--Q--S--P--G--N--G--T--D--T-

-------->
-S--H--*-
TCCCATTAA
 ::::::::
GCCCATTAA
-A--H--*-

Pig Consensus Sequence

>BGISUST0000898014
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
--------------------------------------------------------------------------------TTTTGCTTGGATGGCCAGAG
GCTGGACATGGACCGGGCCCTGAGCAGAAGCTAGGACATTCGGACTCACAGCTGTCCTCAGAGCCCAGGCAATGGCACTGACACCGCCCATTAA


>BGISUSP0000898014
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
------------------------------------------------------------FCLDGQRLDMDRALSRS*DIRTHSCPQSPGNGTDTAH*