Sequences
EST Library Info
cbe1Cerebellum
che3Heart - RNA from China
cje2Jejunum - RNA from China
cki7Kidney - RNA from China
cmu1Rhinal mucous membrane - RNA from China
csk2Skin - RNA from China
cst2Stomach - RNA from China
cte3Testicle - RNA from China
cut2Uterus - RNA from China
eye1Foetus 50 days, Eye
fcc1Unavailable
jej1Small intestine, jejunum
mgp1Mammary gland - 7 days pre birth
nco1Newborn 115 days, colon
nep1Newborn 115 days, epidermis
nje1Newborn 115 days, jejunum
nlu2Newborn 115 days, lung
pfco1Unavailable
rec3Rectum
relu1Unavailable
sme1M. Semimembranosus
spc1Spinal cord
sto6Stomach
uio5Unavailable
ute1Uterus
vin1M. Vastus intermedius
Clusters
Oligos
SNPs

Gene ID ENSG00000129235 (click for geneview)
Transcript ID ENST00000250101(link to ensembl)
Symbol TXNL5
Localtion Chromosome:17:6485051:6487342:1 band: 17p13.1
Description thioredoxin-like 5 [Source:RefSeq_peptide;Acc:NP_116120]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--A--R--Y--E--E-----V--S--V--S-----G--F--E--E--F--H--R--A--V--E--Q--H--N--G--K--T--I--F--A--Y--F--
ATGGCCCGCTATGAGGAG---GTGAGCGTGTCC---GGCTTCGAGGAGTTCCACCGGGCCGTGGAACAGCACAATGGCAAGACCATTTTCGCCTACTTTA
:::::::::::.::::::   ::::::::::::   :::: :::.::::::   :.:::.:::.:.::::::::::::::::::::::::::::::::: 
ATGGCCCGCTACGAGGAGT--GTGAGCGTGTCCT--GGCTACGAAGAGTTCATACAGGCTGTGAAGCAGCACAATGGCAAGACCATTTTCGCCTACTTTT
-M--A--R--Y--E--E--\--V--S--V--S--\--G--Y--E--E--F--I--Q--A--V--K--Q--H--N--G--K--T--I--F--A--Y--F--

--------------------------------------------------><------------------------------------------------
T--G--S--K--D--A--G--G--K--S--W--C--P--D--C--V--Q--A--E--P--V--V--R--E--G--L--K--H--I--S--E--G--C--V
CGGGTTCTAAGGACGCCGGGGGGAAAAGCTGGTGCCCCGACTGCGTGCAGGCTGAACCAGTCGTACGAGAGGGGCTGAAGCACATTAGTGAAGGATGTGT
: ::::::::::::::::..::::::::::::::::::::::::::::::   ::.:::.::.: :::::::::::::::::..:.: :::::. :::::
CCGGTTCTAAGGACGCCGAAGGGAAAAGCTGGTGCCCCGACTGCGTGCAG---GAGCCAATCATTCGAGAGGGGCTGAAGCATGTCACTGAAGACTGTGT
S--G--S--K--D--A--E--G--K--S--W--C--P--D--C--V--Q-----E--P--I--I--R--E--G--L--K--H--V--T--E--D--C--V

--------------------------------><------------------------------------------------------------------
--F--I--Y--C--Q--V--G--E--K--P--Y--W--K--D--P--N--N--D--F--R--K--N--L--K--V--T--A--V--P--T--L--L--K-
GTTCATCTACTGCCAAGTAGGAGAAAAGCCTTATTGGAAAGATCCAAATAATGACTTCAGAAAAAACTTGAAAGTAACAGCAGTGCCTACACTACTTAAG
:::::::::::::::::::::::: ::.:::                                                                     
GTTCATCTACTGCCAAGTAGGAGACAAACCT---------------------------------------------------------------------
--F--I--Y--C--Q--V--G--D--K--P----------------------------------------------------------------------

--------><------------------------------------------------------------------->
-Y--G--T--P--Q--K--L--V--E--S--E--C--L--Q--A--N--L--V--E--M--L--F--S--E--D--*-
TATGGAACACCTCAAAAACTGGTAGAATCTGAGTGTCTTCAGGCCAACCTGGTGGAAATGTTGTTCTCTGAAGATTAA
         :::::::::::::::::::::::::::::::::.::::::: :::::.::::::::::::::::: :::
---------CCTCAAAAACTGGTAGAATCTGAGTGTCTTCAGACCAACCTCGTGGAGATGTTGTTCTCTGAAGAGTAA
----------P--Q--K--L--V--E--S--E--C--L--Q--T--N--L--V--E--M--L--F--S--E--E--*-

Pig Consensus Sequence

>BGISUST0000884568
ATGGCCCGCTACGAGGAggTGAGCGTGTCcgGCTACGAAGAGTTCATACAGGCTGTGAAGCAGCACAATGGCAAGACCATTTTCGCCTACTTTTCCGGTT
CTAAGGACGCCGAAGGGAAAAGCTGGTGCCCCGACTGCGTGCAG---GAGCCAATCATTCGAGAGGGGCTGAAGCATGTCACTGAAGACTGTGTGTTCAT
CTACTGCCAAGTAGGAGACAAACCT---------------------------------------------------------------------------
---CCTCAAAAACTGGTAGAATCTGAGTGTCTTCAGACCAACCTCGTGGAGATGTTGTTCTCTGAAGAGTAA


>BGISUSP0000884568
MARYEEVSVSGYEEFIQAVKQHNGKTIFAYFSGSKDAEGKSWCPDCVQ-EPIIREGLKHVTEDCVFIYCQVGDKP-------------------------
-PQKLVESECLQTNLVEMLFSEE*