Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000137315 (click for geneview)
Transcript ID ENST00000252229(link to ensembl)
Symbol MICB
Localtion Chromosome:6:31573842:31586879:1 band: 6p21.33
Description MHC class I polypeptide-related sequence B [Source:RefSeq_peptide;Acc:NP_005922]
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<--------------------------------------------------------------------><-----------------------------
-M--G--L--G--R--V--L--L--F--L--A--V--A--F--P--F--A--P--P--A--A--A--A--E--P--H--S--L--R--Y--N--L--M--
ATGGGGCTGGGCCGGGTCCTGCTGTTTCTGGCCGTCGCCTTCCCTTTTGCACCCCCGGCAGCCGCCGCTGAGCCCCACAGTCTTCGTTACAACCTCATGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
V--L--S--Q--D--G--S--V--Q--S--G--F--L--A--E--G--H--L--D--G--Q--P--F--L--R--Y--D--R--Q--K--R--R--A--K
TGCTGTCCCAGGATGGATCTGTGCAGTCAGGGTTTCTCGCTGAGGGACATCTGGATGGTCAGCCCTTCCTGCGCTATGACAGGCAGAAACGCAGGGCAAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--P--Q--G--Q--W--A--E--N--V--L--G--A--K--T--W--D--T--E--T--E--D--L--T--E--N--G--Q--D--L--R--R--T--L-
GCCCCAGGGACAGTGGGCAGAAAATGTCCTGGGAGCTAAGACCTGGGACACAGAGACCGAGGACTTGACAGAGAATGGGCAAGACCTCAGGAGGACCCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------><--------------------------------------------------------------------------
-T--H--I--K--D--Q--K--G--G--L--H--S--L--Q--E--I--R--V--C--E--I--H--E--D--S--S--T--R--G--S--R--H--F--
ACTCATATCAAGGACCAGAAAGGAGGCTTGCATTCCCTCCAGGAGATTAGGGTCTGTGAGATCCATGAAGACAGCAGCACCAGGGGCTCCCGGCATTTCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
Y--Y--D--G--E--L--F--L--S--Q--N--L--E--T--Q--E--S--T--V--P--Q--S--S--R--A--Q--T--L--A--M--N--V--T--N
ACTACGATGGGGAGCTCTTCCTCTCCCAAAACCTGGAGACTCAAGAATCGACAGTGCCCCAGTCCTCCAGAGCTCAGACCTTGGCTATGAACGTCACAAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--F--W--K--E--D--A--M--K--T--K--T--H--Y--R--A--M--Q--A--D--C--L--Q--K--L--Q--R--Y--L--K--S--G--V--A-
TTTCTGGAAGGAAGATGCCATGAAGACCAAGACACACTATCGCGCTATGCAGGCAGACTGCCTGCAGAAACTACAGCGATATCTGAAATCCGGGGTGGCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------><--------------------------------------------------------------------------------------
-I--R--R--T--V--P--P--M--V--N--V--T--C--S--E--V--S--E--G--N--I--T--V--T--C--R--A--S--S--F--Y--P--R--
ATCAGGAGAACAGTGCCCCCCATGGTGAATGTCACCTGCAGCGAGGTCTCAGAGGGCAACATCACCGTGACATGCAGGGCTTCCAGCTTCTATCCCCGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
N--I--T--L--T--W--R--Q--D--G--V--S--L--S--H--N--T--Q--Q--W--G--D--V--L--P--D--G--N--G--T--Y--Q--T--W
ATATCACACTGACCTGGCGTCAGGATGGGGTATCTTTGAGCCACAACACCCAGCAGTGGGGGGATGTCCTGCCTGATGGGAATGGAACCTACCAGACCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------------------------------------><-------
--V--A--T--R--I--R--Q--G--E--E--Q--R--F--T--C--Y--M--E--H--S--G--N--H--G--T--H--P--V--P--S--G--K--A-
GGTGGCCACCAGGATTCGCCAAGGAGAGGAGCAGAGGTTCACCTGCTACATGGAACACAGCGGGAATCACGGCACTCACCCTGTGCCCTCTGGGAAGGCG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-L--V--L--Q--S--Q--R--T--D--F--P--Y--V--S--A--A--M--P--C--F--V--I--I--I--I--L--C--V--P--C--C--K--K--
CTGGTGCTTCAGAGTCAACGGACAGACTTTCCATATGTTTCTGCTGCTATGCCATGTTTTGTTATTATTATTATTCTCTGTGTCCCTTGTTGCAAGAAGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------><---------------------------------------------------------------------------
K--T--S--A--A--E--G--P--E--L--V--S--L--Q--V--L--D--Q--H--P--V--G--T--G--D--H--R--D--A--A--Q--L--G--F
AAACATCAGCGGCAGAGGGTCCAGAGCTTGTGAGCCTGCAGGTCCTGGATCAACACCCAGTTGGGACAGGAGACCACAGGGATGCAGCACAGCTGGGATT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------->
--Q--P--L--M--S--A--T--G--S--T--G--S--T--E--G--T--*-
TCAGCCTCTGATGTCAGCTACTGGGTCCACTGGTTCCACTGAGGGCACCTAG
                                                    
----------------------------------------------------
----------------------------------------------------