Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000169951 (click for geneview)
Transcript ID ENST00000252797(link to ensembl)
Symbol NP_219363.1
Localtion Chromosome:16:30472587:30477085:-1 band: 16p11.2
Description hypothetical protein MGC13138
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--A--P--P--L--A--P--L--P--P--R--D--P--N--G--A--G--P--E--W--R--E--P--G--A--V--S--F--A--D--V--A--V--
ATGGCGCCGCCTCTGGCCCCGCTCCCTCCCCGGGACCCAAACGGGGCCGGACCCGAGTGGAGGGAGCCGGGGGCTGTGAGCTTCGCGGACGTGGCCGTGT
                                                                           :: :. :::::::::::::::::::
---------------------------------------------------------------------------GTTAAGTTCGCGGACGTGGCCGTGT
----------------------------------------------------------------------------V--K--F--A--D--V--A--V--

-----------------------------------------------------------------------------------------------><---
Y--F--C--R--E--E--W--G--C--L--R--P--A--Q--R--A--L--Y--R--D--V--M--R--E--T--Y--G--H--L--S--A--L--G--I
ACTTCTGCCGGGAGGAGTGGGGCTGCTTGCGGCCAGCGCAGAGGGCCCTGTACCGGGACGTGATGCGGGAGACCTACGGCCACCTGAGCGCTCTCGGAAT
:::::: :: :::::::::::  :...::::::: :::::::.:::::: ::.:::::::::::::: ::::::::::::: ::::.:::: :::     
ACTTCTCCCCGGAGGAGTGGGCGTATCTGCGGCCCGCGCAGAAGGCCCTCTATCGGGACGTGATGCGCGAGACCTACGGCCTCCTGGGCGCGCTC-----
Y--F--S--P--E--E--W--A--Y--L--R--P--A--Q--K--A--L--Y--R--D--V--M--R--E--T--Y--G--L--L--G--A--L------

----------------------------------------------------------------------------------------------------
--G--G--N--K--P--A--L--I--S--W--V--E--E--E--A--E--L--W--G--P--A--A--Q--D--P--E--V--A--K--C--Q--T--Q-
CGGAGGCAACAAGCCAGCTCTCATCTCCTGGGTGGAGGAGGAGGCCGAACTGTGGGGTCCGGCTGCCCAGGATCCGGAGGTGGCGAAATGTCAGACACAA
    :::: :::::::::.:::::::::::::::::: :.:::::::::::::::::::..:  ::: .:::::::::::::: ..:.:::: :::: :.
----GGCACCAAGCCAGCCCTCATCTCCTGGGTGGAGCAAGAGGCCGAACTGTGGGGTCTAGAGGCCAGGGATCCGGAGGTGGGAGAGTGTCTGACAGAG
-----G--T--K--P--A--L--I--S--W--V--E--Q--E--A--E--L--W--G--L--E--A--R--D--P--E--V--G--E--C--L--T--E-

---------><-----------------------------------------------------------------------------------------
-T--D--P--A--D--S--R--N--K--K--K--E--R--Q--R--E--G--T--G--A--L--E--K--P--D--P--V--A--A--G--S--P--G--
ACGGACCCAGCAGATTCCAGAAACAAGAAAAAGGAAAGACAAAGGGAAGGGACGGGAGCCCTGGAGAAGCCCGACCCTGTGGCCGCCGGGTCTCCTGGGC
.:.:::                                                                                              
GCAGAC----------------------------------------------------------------------------------------------
-A--D-----------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
L--K--S--P--Q--A--P--S--A--G--P--P--Y--G--W--E--Q--L--S--K--A--P--H--R--G--R--P--S--L--C--A--H--P--P
TGAAGTCTCCCCAAGCCCCCTCGGCCGGGCCCCCTTATGGTTGGGAGCAGCTGTCCAAGGCACCGCACCGGGGACGCCCCTCCCTCTGTGCCCACCCCCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--V--P--R--A--D--Q--R--H--G--C--Y--V--C--G--K--S--F--A--W--R--S--T--L--V--E--H--V--Y--S--H--T--G--E-
TGTCCCCCGAGCTGACCAGCGTCATGGCTGCTACGTGTGCGGGAAGAGCTTTGCCTGGCGCTCCACACTGGTGGAGCACGTCTACAGTCACACTGGCGAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-K--P--F--H--C--T--D--C--G--K--G--F--G--H--A--S--S--L--S--K--H--R--A--I--H--R--G--E--R--P--H--R--C--
AAGCCCTTCCACTGCACTGACTGCGGCAAGGGCTTCGGCCACGCTTCCTCCCTGAGCAAACACCGGGCCATCCATCGTGGGGAGCGGCCCCACCGCTGTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
L--E--C--G--R--A--F--T--Q--R--S--A--L--T--S--H--L--R--V--H--T--G--E--K--P--Y--G--C--A--D--C--G--R--R
TGGAGTGTGGCCGGGCCTTCACGCAGCGCTCGGCGCTGACTTCGCACCTGCGCGTCCACACCGGCGAGAAACCCTATGGCTGCGCCGACTGTGGCCGCCG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--F--S--Q--S--S--A--L--Y--Q--H--R--R--V--H--S--G--E--T--P--F--P--C--P--D--C--G--R--A--F--A--Y--P--S-
CTTCAGCCAGAGCTCTGCCCTCTACCAGCACCGGCGCGTGCACAGCGGCGAGACCCCCTTCCCCTGCCCGGACTGTGGCCGCGCCTTCGCCTACCCCTCG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-D--L--R--R--H--V--R--T--H--T--G--E--K--P--Y--P--C--P--D--C--G--R--C--F--R--Q--S--S--E--M--A--A--H--
GACCTGCGGCGCCACGTGCGCACCCACACCGGCGAGAAGCCCTACCCGTGCCCGGACTGCGGGCGCTGCTTCCGCCAGAGCTCGGAGATGGCAGCCCACA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
R--R--T--H--S--G--E--K--P--Y--P--C--P--Q--C--G--R--R--F--G--Q--K--S--A--V--A--K--H--Q--W--V--H--R--P
GGCGCACCCACAGCGGCGAGAAGCCCTACCCCTGCCCGCAGTGCGGCCGCCGCTTTGGCCAGAAGTCAGCCGTGGCCAAACACCAGTGGGTTCATCGGCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--G--A--G--G--H--R--G--R--V--A--G--R--L--S--V--T--L--T--P--G--H--G--D--L--D--P--P--V--G--F--Q--L--Y-
CGGGGCCGGGGGCCACAGGGGCCGGGTCGCCGGGCGTCTGTCTGTGACCCTGACCCCTGGCCACGGAGACCTGGACCCGCCCGTGGGCTTCCAGCTGTAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------->
-P--E--I--F--Q--E--C--G--*-
CCGGAGATATTCCAGGAGTGTGGGTGA
                           
---------------------------
---------------------------

Pig Consensus Sequence

>BGISUST0000876479
---------------------------------------------------------------------------GTTAAGTTCGCGGACGTGGCCGTGT
ACTTCTCCCCGGAGGAGTGGGCGTATCTGCGGCCCGCGCAGAAGGCCCTCTATCGGGACGTGATGCGCGAGACCTACGGCCTCCTGGGCGCGCTC-----
----GGCACCAAGCCAGCCCTCATCTCCTGGGTGGAGCAAGAGGCCGAACTGTGGGGTCTAGAGGCCAGGGATCCGGAGGTGGGAGAGTGTCTGACAGAG
GCAGAC----------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
---------------------------


>BGISUSP0000876479
-------------------------VKFADVAVYFSPEEWAYLRPAQKALYRDVMRETYGLLGAL---GTKPALISWVEQEAELWGLEARDPEVGECLTE
AD--------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
---------