Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000169955 (click for geneview)
Transcript ID ENST00000252799(link to ensembl)
Symbol NP_076420.1
Localtion Chromosome:16:30450281:30453695:-1 band: 16p11.2
Description hypothetical protein MGC2474
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--T--D--P--S--L--G--L--T--V--P--M--A--P--P--L--A--P--L--P--P--R--D--P--N--G--A--G--S--E--W--R--K--
ATGACCGATCCGTCGCTGGGGCTGACAGTCCCCATGGCGCCGCCTCTGGCCCCGCTCCCTCCCCGGGACCCAAACGGGGCGGGATCCGAGTGGAGAAAGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
P--G--A--V--S--F--A--D--V--A--V--Y--F--S--R--E--E--W--G--C--L--R--P--A--Q--R--A--L--Y--R--D--V--M--R
CCGGGGCCGTGAGCTTCGCCGACGTGGCCGTGTACTTCTCCCGGGAGGAGTGGGGCTGCCTGCGGCCCGCGCAGAGGGCCCTGTACCGGGACGTGATGCG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--E--T--Y--G--H--L--G--A--L--G--E--S--P--T--C--L--P--G--P--C--A--S--T--G--P--A--A--P--L--G--A--A--C-
GGAGACCTACGGCCACCTGGGCGCGCTCGGTGAGAGCCCCACCTGCTTGCCTGGGCCCTGCGCCTCCACAGGCCCTGCCGCGCCTCTGGGAGCTGCGTGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-G--V--G--G--P--G--A--G--Q--A--A--S--S--Q--R--G--V--C--V--L--L--P--Q--E--S--E--A--A--S--R--R--S--S--
GGAGTTGGGGGCCCCGGGGCCGGGCAGGCGGCCTCCTCGCAGCGTGGGGTTTGCGTTCTTCTCCCCCAGGAGTCGGAGGCAGCAAGCCGGCGCTCATCTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------><----------------
P--G--W--R--R--R--P--N--C--G--I--R--L--P--R--I--R--R--W--R--S--V--R--Q--K--R--T--Q--Q--I--P--E--T--R
CTGGGTGGAGGAGAAGGCCGAACTGTGGGATCCGGCTGCCCAGGATCCGGAGGTGGCGAAGTGTCCGACAGAAGCGGACCCAGCAGATTCCAGAAACAAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------->
--K--R--K--D--K--G--K--G--R--E--P--W--R--S--P--T--L--W--P--P--G--L--L--G--*-
GAAGAGGAAAGACAAAGGGAAGGGACGGGAGCCCTGGAGAAGCCCGACCCTGTGGCCGCCGGGTCTCCTGGGCTGA
                                                                            
----------------------------------------------------------------------------
----------------------------------------------------------------------------