Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000130711 (click for geneview)
Transcript ID ENST00000253008(link to ensembl)
Symbol PRDM12
Localtion Chromosome:9:130569535:130587938:1 band: 9q34.12
Description PR-domain zinc finger protein 12. [Source:Uniprot/SWISSPROT;Acc:Q9H4Q4]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--M--G--S--V--L--P--A--E--A--L--V--L--K--T--G--L--K--A--P--G--L--A--L--A--E--V--I--T--S--D--I--L--
ATGATGGGCTCCGTGCTCCCGGCTGAGGCCCTGGTGCTCAAGACCGGGCTGAAGGCGCCGGGACTGGCGCTGGCCGAGGTTATCACCTCCGACATCCTGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
H--S--F--L--Y--G--R--W--R--N--V--L--G--E--Q--L--F--E--D--K--S--H--H--A--S--P--K--T--A--F--T--A-----E
ACAGCTTCCTGTACGGCCGCTGGCGCAACGTGCTCGGGGAGCAGCTCTTCGAGGACAAGAGCCACCACGCCAGCCCCAAGACAGCCTTCACCGCC---GA
           ::::: ::::::::::::::::: :: ::::::::::::::.::::::::::::::::::::::::::::::::::::::::::   ::
-----------TACGGGCGCTGGCGCAACGTGCTGGGCGAGCAGCTCTTCGAAGACAAGAGCCACCACGCCAGCCCCAAGACAGCCTTCACCGCCT--GA
------------Y--G--R--W--R--N--V--L--G--E--Q--L--F--E--D--K--S--H--H--A--S--P--K--T--A--F--T--A--\--E

-------------------------><-------------------------------------------------------------------------
--V--L--A--Q--S--F--S--G--E--V--Q--K--L--S--S--L--V--L--P--A--E--V--I--I--A--Q--S--S--I--P--G--E--G-
GGTGCTGGCGCAGTCCTTCTCCGGCGAAGTGCAGAAGCTGTCCAGCCTGGTGCTGCCTGCGGAGGTGATCATCGCTCAGAGCTCCATCCCTGGCGAGGGC
::: :::::.:::::::::::::::   :: :::::::::::::::::::::::::: ::::::::::::::.:: :::::::::::.::.:::::::::
GGTCCTGGCACAGTCCTTCTCCGGC---GTTCAGAAGCTGTCCAGCCTGGTGCTGCCGGCGGAGGTGATCATTGCGCAGAGCTCCATTCCCGGCGAGGGC
--V--L--A--Q--S--F--S--G-----V--Q--K--L--S--S--L--V--L--P--A--E--V--I--I--A--Q--S--S--I--P--G--E--G-

----------------------------------------------------------------------------------------------------
-L--G--I--F--S--K--T--W--I--K--A--G--T--E--M--G--P--F--T--G--R--V--I--A--P--E--H--V--D--I--C--K--N--
CTCGGCATCTTCTCCAAGACGTGGATCAAGGCGGGAACCGAGATGGGCCCCTTCACCGGCCGCGTGATCGCCCCGGAGCACGTGGACATCTGCAAGAACA
::.:::::::::::::::::::::::::::::::: :: :::::::::::::::::::::::::: :::::.:: :::::.:::::::::::::::::::
CTTGGCATCTTCTCCAAGACGTGGATCAAGGCGGGCACGGAGATGGGCCCCTTCACCGGCCGCGTCATCGCTCCCGAGCATGTGGACATCTGCAAGAACA
-L--G--I--F--S--K--T--W--I--K--A--G--T--E--M--G--P--F--T--G--R--V--I--A--P--E--H--V--D--I--C--K--N--

----------------><----------------------------------------------------------------------------------
N--N--L--M--W--E--V--F--N--E--D--G--T--V--R--Y--F--I--D--A--S--Q--E--D--H--R--S--W--M--T--Y--I--K--C
ACAACCTCATGTGGGAGGTGTTCAATGAGGATGGCACGGTGCGCTACTTCATCGATGCCAGCCAGGAGGACCACCGGAGCTGGATGACCTACATCAAGTG
:::::::::::::::::                                                                                   
ACAACCTCATGTGGGAG-----------------------------------------------------------------------------------
N--N--L--M--W--E------------------------------------------------------------------------------------

------------------------------------------------------------------------><--------------------------
--A--R--N--E--Q--E--Q--N--L--E--V--V--Q--I--G--T--S--I--F--Y--K--A--I--E--M--I--P--P--D--Q--E--L--L-
TGCACGTAACGAACAGGAGCAGAACCTGGAGGTGGTCCAGATCGGCACCAGCATCTTCTACAAGGCCATTGAGATGATCCCACCTGACCAGGAACTGCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------------------------------><--------------
-V--W--Y--G--N--S--H--N--T--F--L--G--I--P--G--V--P--G--L--E--E--D--Q--K--K--N--K--H--E--D--F--H--P--
GTGTGGTACGGAAACTCACACAACACCTTCCTGGGGATCCCAGGTGTGCCCGGGCTAGAGGAGGACCAGAAAAAGAACAAGCATGAGGACTTCCACCCGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
A--D--S--A--A--G--P--A--G--R--M--R--C--V--I--C--H--R--G--F--N--S--R--S--N--L--R--S--H--M--R--I--H--T
CGGACTCGGCGGCTGGCCCCGCGGGCCGCATGCGATGCGTCATCTGCCACCGCGGCTTCAACTCGCGCAGCAACCTGCGCTCGCACATGCGCATCCACAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--L--D--K--P--F--V--C--R--F--C--N--R--R--F--S--Q--S--S--T--L--R--N--H--V--R--L--H--T--G--E--R--P--Y-
GCTGGACAAGCCCTTCGTGTGCCGCTTCTGCAACCGCCGCTTCAGCCAGTCGTCCACGCTGCGCAACCACGTGCGCCTGCACACGGGCGAGCGCCCCTAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-K--C--Q--V--C--Q--S--A--Y--S--Q--L--A--G--L--R--A--H--Q--K--S--A--R--H--R--P--P--S--T--A--L--Q--A--
AAGTGCCAGGTGTGCCAGAGCGCCTACTCGCAGCTGGCCGGCCTGCGCGCCCACCAGAAGAGCGCGCGGCACCGGCCGCCCAGCACCGCGCTGCAGGCAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
H--S--P--A--L--P--A--P--H--A--H--A--P--A--L--A--A--A--A--A--A--A--A--A--A--A--A--H--H--L--P--A--M--V
ACTCGCCCGCGCTGCCCGCCCCGCACGCGCACGCGCCCGCGCTCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCGCACCACCTGCCGGCCATGGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------>
--L--*-
GCTGTGA
       
-------
-------

Pig Consensus Sequence

>BGISUST0000880914
----------------------------------------------------------------------------------------------------
-----------TACGGGCGCTGGCGCAACGTGCTGGGCGAGCAGCTCTTCGAAGACAAGAGCCACCACGCCAGCCCCAAGACAGCCTTCACCGCcgAGGT
CCTGGCACAGTCCTTCTCCGGC---GTTCAGAAGCTGTCCAGCCTGGTGCTGCCGGCGGAGGTGATCATTGCGCAGAGCTCCATTCCCGGCGAGGGCCTT
GGCATCTTCTCCAAGACGTGGATCAAGGCGGGCACGGAGATGGGCCCCTTCACCGGCCGCGTCATCGCTCCCGAGCATGTGGACATCTGCAAGAACAACA
ACCTCATGTGGGAG--------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----


>BGISUSP0000880914
-------------------------------------YGRWRNVLGEQLFEDKSHHASPKTAFTAEVLAQSFSG-VQKLSSLVLPAEVIIAQSSIPGEGL
GIFSKTWIKAGTEMGPFTGRVIAPEHVDICKNNNLMWE--------------------------------------------------------------
----------------------------------------------------------------------------------------------------
--------------------------------------------------------------------