Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000131165 (click for geneview)
Transcript ID ENST00000253475(link to ensembl)
Symbol NP_002759.1
Localtion Chromosome:16:88238346:88251712:-1 band: 16q24.3
Description procollagen (type III) N-endopeptidase [Source:RefSeq_peptide;Acc:NP_002759]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-------------><----------------------------------------------><------------------------------------
-M--A--T--A--R--S--R--A--P--P--L--W--R--D--R--P--P--S--S--R--E--H--P--V--R--P--E--V--G--R--R--P--R--
ATGGCGACCGCGCGCAGCCGCGCCCCGCCCCTCTGGCGGGACCGGCCACCATCCTCTCGCGAGCATCCCGTGCGACCGGAAGTGGGGCGGCGACCCCGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
K--S--P--P--G--A--A--W--S--V--R--S--P--P--G--P--D--T--A--R--S--W--R--P--F--S--L--S--E--C--C--S--C--H
AGTCCCCGCCGGGTGCAGCTTGGTCGGTTCGATCGCCGCCGGGACCTGACACCGCCCGGAGTTGGCGTCCCTTCTCCCTCTCCGAGTGCTGCTCCTGTCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------><-----------------><-----------------------------------------------------------------
--C--G--H--G--R--T--F--R--L--P--L--V--H--G--E--A--A--G--E--A--G--Q--E--G--G--E--G--L--Q--G--G--A--G-
TTGTGGCCATGGACGGACATTCCGGCTTCCGCTCGTTCACGGCGAAGCAGCTGGAGAAGCTGGCCAAGAAGGCGGAGAAGGACTCCAAGGCGGAGCAGGC
                                  ::::::.:::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
----------------------------------GTTCACAGCGAAGCAGCTGGAGAAGCTGGCCAAGAAGGCGGAGAAGGACTCCAAGGCGGAGCAGGC
-----------------------------------V--H--S--E--A--A--G--E--A--G--Q--E--G--G--E--G--L--Q--G--G--A--G-

------------><--------------------------------------------------------------------------------------
-Q--S--E--E--G--P--S--A--E--K--C--R--V--C--P--C--V--C--R--E--R--H--P--Q--E--E--R--R--C--E--L--A--S--
CAAAGTGAAGAAGGCCCTTCTGCAGAAAAATGTAGAGTGTGCCCGTGTGTATGCCGAGAACGCCATCCGCAAGAAGAACGAAGGTGTGAACTGGCTTCGG
:::.::::::::   ::::: ::::::.::.::.:::::::: :: :::::.::::::::::::::.:::::::::::.::.:::::::::::::: :: 
CAAGGTGAAGAA---CCTTCAGCAGAAGAACGTGGAGTGTGCGCGGGTGTACGCCGAGAACGCCATTCGCAAGAAGAATGAGGGTGTGAACTGGCTGCGC
-Q--G--E--E-----P--S--A--E--E--R--G--V--C--A--G--V--R--R--E--R--H--S--Q--E--E--*--G--C--E--L--A--A--

-----------------------------------------------------------><---------------------------------------
D--G--V--P--R--R--R--S--G--L--Q--G--A--D--S--C--D--Y--E--G--G--D--Q--E--Y--G--P--G--D--Q--S--P--G--Q
ATGGCGTCCCGCGTAGACGCAGTGGCCTCCAAGGTGCAGACAGCTGTGACTATGAAGGGGGTGACCAAGAATATGGCCCAGGTGACCAAAGCCCTGGACA
::::::::::::::.::.::.::::::::::::::::::::.::.:::::.::::::::   ::: :::::.::::: ::::::::::::::::::::: 
ATGGCGTCCCGCGTGGATGCGGTGGCCTCCAAGGTGCAGACGGCCGTGACCATGAAGGG---GACGAAGAACATGGCACAGGTGACCAAAGCCCTGGACC
H--G--V--P--R--G--C--G--G--L--Q--G--A--D--G--R--D--H--E--G-----D--E--E--H--G--T--G--D--Q--S--P--G--P

----------------------------------------------------------------------------------------><----------
--G--P--E--H--H--G--P--A--E--G--L--L--S--D--G--Q--V--R--A--A--G--A--E--P--G--R--P--Y--I--G--D--G--G-
AGGCCCTGAGCACCATGGACCTGCAGAAGGTCTCCTCAGTGATGGACAGGTTCGAGCAGCAGGTGCAGAACCTGGACGTCCATACATCGGTGATGGAGGA
. :: :: ::::::::::::::::::::::::::. :.::::::::.:.:::.:::::::::::::::::::::::               :::::::::
GCGCGCTCAGCACCATGGACCTGCAGAAGGTCTCTGCGGTGATGGATAAGTTTGAGCAGCAGGTGCAGAACCTGGA---------------GATGGAGGA
--R--A--Q--H--H--G--P--A--E--G--L--C--G--D--G--*--V--*--A--A--G--A--E--P--G-----------------D--G--G-

----------------------------------------------------------------------------------------------------
-L--H--E--L--G--H--H--P--D--H--A--A--G--A--G--G--Q--P--H--H--A--D--R--R--G--E--W--P--G--G--A--G--P--
CTCCATGAGCTCGGCCACCACCCTGACCACGCCGCAGGAGCAGGTGGACAGCCTCATCATGCAGATCGCCGAGGAGAATGGCCTGGAGGTGCTGGACCAG
::::::::::::::::::::: :::::::::::::::::::::::::::::::::::::::::::::::.::::::::.::::::::::: :::::::::
CTCCATGAGCTCGGCCACCACGCTGACCACGCCGCAGGAGCAGGTGGACAGCCTCATCATGCAGATCGCTGAGGAGAACGGCCTGGAGGTCCTGGACCAG
-L--H--E--L--G--H--H--A--D--H--A--A--G--A--G--G--Q--P--H--H--A--D--R--*--G--E--R--P--G--G--P--G--P--

----------------------------------------------------------------------------><----------------------
A--Q--P--A--A--R--G--R--L--C--R--G--R--E--L--C--A--Q--P--G--G--P--A--V--T--E--V--G--R--L--E--E--L--A
CTCAGCCAGCTGCCCGAGGGCGCCTCTGCCGTGGGCGAGAGCTCTGTGCGCAGCCAGGAGGACCAGCTGTCACGGAGGTTGGCCGCCTTGAGGAACTAGC
::::::::::::::::::::::::::.:::::::::::::::::.:::::::::::::::::::::::.:: :::::                       
CTCAGCCAGCTGCCCGAGGGCGCCTCCGCCGTGGGCGAGAGCTCCGTGCGCAGCCAGGAGGACCAGCTATCTCGGAG-----------------------
A--Q--P--A--A--R--G--R--L--R--R--G--R--E--L--R--A--Q--P--G--G--P--A--I--S--E------------------------

----------------------------------------------------------------------------------------------------
--V--P--R--R--C--A--P--P--L--P--R--D--V--L--E--G--S--C--P--L--P--T--A--S--C--L--C--A--D--P--A--G--L-
CGTGCCCCGCCGGTGTGCACCGCCTCTGCCCCGTGATGTGCTGGAAGGCTCCTGTCCTCTCCCCACCGCGTCTTGCCTTTGTGCTGACCCCGCGGGGCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------->
-R--P--A--A--T--L--R--L--S--P--A--R--P--A--W--P--*-
CGGCCGGCAGCCACTCTGCGTCTCTCACCTGCCAGGCCTGCGTGGCCTTAG
                                                   
---------------------------------------------------
---------------------------------------------------

Pig Consensus Sequence

>BGISUST0000890116
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------GTTCACAGCGAAGCAGCTGGAGAAGCTGGCCAAGAAGGCGGAGAAGGACTCCAAGGCGGAGCAGGC
CAAGGTGAAGAA---CCTTCAGCAGAAGAACGTGGAGTGTGCGCGGGTGTACGCCGAGAACGCCATTCGCAAGAAGAATGAGGGTGTGAACTGGCTGCGC
ATGGCGTCCCGCGTGGATGCGGTGGCCTCCAAGGTGCAGACGGCCGTGACCATGAAGGG---GACGAAGAACATGGCACAGGTGACCAAAGCCCTGGACC
GCGCGCTCAGCACCATGGACCTGCAGAAGGTCTCTGCGGTGATGGATAAGTTTGAGCAGCAGGTGCAGAACCTGGA---------------GATGGAGGA
CTCCATGAGCTCGGCCACCACGCTGACCACGCCGCAGGAGCAGGTGGACAGCCTCATCATGCAGATCGCTGAGGAGAACGGCCTGGAGGTCCTGGACCAG
CTCAGCCAGCTGCCCGAGGGCGCCTCCGCCGTGGGCGAGAGCTCCGTGCGCAGCCAGGAGGACCAGCTATCTCGGAG-----------------------
----------------------------------------------------------------------------------------------------
---------------------------------------------------


>BGISUSP0000890116
------------------------------------------------------------------------------VHSEAAGEAGQEGGEGLQGGAG
QGEE-PSAEERGVCAGVRRERHSQEE*GCELAAHGVPRGCGGLQGADGRDHEG-DEEHGTGDQSPGPRAQHHGPAEGLCGDG*V*AAGAEPG-----DGG
LHELGHHADHAAGAGGQPHHADR*GERPGGPGPAQPAARGRLRRGRELRAQPGGPAISE-----------------------------------------
-----------------