Sequences
EST Library Info
cje4Jejunum - RNA from China
cki1Kidney - RNA from China
cov1Ovary - RNA from China
csp3Spleen - RNA from China
cst2Stomach - RNA from China
cut1Uterus - RNA from China
eep1Foetus 50 days, epidermis
eje1Foetus 50 days, jejunum
ese2Foetus 50 days, M. semitendinosus
eye4Foetus 50 days, Eye
fcc1Unavailable
hea3Heart
hyp1Hypothalamus
isp1M. Infraspinatus
lnt1Lymphatic nodule tracheobroncalis
nbm1Newborn 115 days, bone marrow (pelvis)
nca1Newborn 115 days, cartillage
nco1Newborn 115 days, colon
nje2Newborn 115 days, jejunum
ova1Ovary
pigcb2Unavailable
plac1Unavailable
sme1M. Semimembranosus
tes1Testes
thg1Thyroid gland
Clusters
Oligos
SNPs

Gene ID ENSG00000134248 (click for geneview)
Transcript ID ENST00000256644(link to ensembl)
Symbol HBXIP
Localtion Chromosome:1:110655921:110662606:-1 band: 1p13.3
Description Hepatitis B virus X interacting protein (HBX-interacting protein) (HBV X interacting protein). [Source:Uniprot/SWISSPROT;Acc:O43504]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--E--P--G--A--G--H--L--D--G--H--R--A--G--S--P--S--L--R--Q--A--L--C--D--G--S--A--V--M--F--S--S--K--
ATGGAGCCAGGTGCAGGTCACCTCGACGGTCACCGCGCGGGGAGCCCAAGCCTTCGTCAGGCTCTGTGCGACGGAAGCGCAGTGATGTTTTCCAGTAAAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
E--R--G--R--C--T--V--I--N--F--V--P--L--E--A--P--L--R--S--T--P--R--S--R--Q--V--T--E--A--C--G--G--E--G
AACGCGGACGTTGCACCGTGATCAATTTTGTCCCTTTGGAGGCGCCGTTACGGTCCACGCCCCGCTCGCGTCAAGTGACTGAGGCCTGTGGTGGAGAAGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------------><------------------
--R--A--V--P--L--G--S--E--P--E--W--S--V--G--G--M--E--A--T--L--E--Q--H--L--E--D--T--M--K--N--P--S--I-
ACGTGCCGTGCCGCTGGGTTCTGAGCCGGAGTGGTCGGTGGGTGGGATGGAGGCGACCTTGGAGCAGCACTTGGAAGACACAATGAAGAATCCCTCCATT
                                        ::.:::::::::::.::::::::::::::::::::.:::   ::::::::::: ::::::
----------------------------------------GGCGGGATGGAGGCAACCTTGGAGCAGCACTTGGAGGAC---ATGAAGAATCCATCCATT
-----------------------------------------G--G--M--E--A--T--L--E--Q--H--L--E--D-----M--K--N--P--S--I-

------------------------------------------><--------------------------------------------------------
-V--G--V--L--C--T--D--S--Q--G--L--N--L--G--C--R--G--T--L--S--D--E--H--A--G--V--I--S--V--L--A--Q--Q--
GTTGGAGTCCTGTGCACAGATTCACAAGGACTTAATCTGGGTTGCCGCGGGACCCTGTCAGATGAGCATGCTGGAGTGATATCTGTTCTAGCCCAGCAAG
::::::::::::::::::::::::::::::::.::::::      :: ::::::::::: ::::::::::::::.:::::::::::.:::::::::::::
GTTGGAGTCCTGTGCACAGATTCACAAGGACTCAATCTG------CGAGGGACCCTGTCTGATGAGCATGCTGGGGTGATATCTGTCCTAGCCCAGCAAG
-V--G--V--L--C--T--D--S--Q--G--L--N--L--------R--G--T--L--S--D--E--H--A--G--V--I--S--V--L--A--Q--Q--

------------------------------------------------------------><--------------------------------------
A--A--K--L--T--S--D--P--T--D--I--P--V--V--C--L--E--S--D--N--G--N--I--M--I--Q--K--H--D--G--I--T--V--A
CAGCTAAGCTAACCTCTGACCCCACTGATATTCCTGTGGTGTGTCTAGAATCAGATAATGGGAACATTATGATCCAGAAACACGATGGCATCACGGTGGC
:::::::::::::::: ::::::::.::::::::::: ::::::::::::::::::      :::::.:::::::::::.::::::::::::::.:::::
CAGCTAAGCTAACCTCAGACCCCACCGATATTCCTGTCGTGTGTCTAGAATCAGAT------AACATCATGATCCAGAAGCACGATGGCATCACAGTGGC
A--A--K--L--T--S--D--P--T--D--I--P--V--V--C--L--E--S--D--------N--I--M--I--Q--K--H--D--G--I--T--V--A

--------------------->
--V--H--K--M--A--S--*-
AGTGCACAAAATGGCCTCTTGA
 :::::.:::::::::::::::
CGTGCATAAAATGGCCTCTTGA
--V--H--K--M--A--S--*-

Pig Consensus Sequence

>BGISUST0000895598
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------GGCGGGATGGAGGCAACCTTGGAGCAGCACTTGGAGGAC---ATGAAGAATCCATCCATT
GTTGGAGTCCTGTGCACAGATTCACAAGGACTCAATCTG------CGAGGGACCCTGTCTGATGAGCATGCTGGGGTGATATCTGTCCTAGCCCAGCAAG
CAGCTAAGCTAACCTCAGACCCCACCGATATTCCTGTCGTGTGTCTAGAATCAGAT------AACATCATGATCCAGAAGCACGATGGCATCACAGTGGC
CGTGCATAAAATGGCCTCTTGA


>BGISUSP0000895598
--------------------------------------------------------------------------------GGMEATLEQHLED-MKNPSI
VGVLCTDSQGLNL--RGTLSDEHAGVISVLAQQAAKLTSDPTDIPVVCLESD--NIMIQKHDGITVAVHKMAS*