Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000135097 (click for geneview)
Transcript ID ENST00000257552(link to ensembl)
Symbol MSI1
Localtion Chromosome:12:119241853:119269678:-1 band: 12q24.23
Description RNA-binding protein Musashi homolog 1 (Musashi-1). [Source:Uniprot/SWISSPROT;Acc:O43347]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------><--------------------------------------->
-M--E--T--D--A--P--Q--P--G--L--A--S--P--D--S--P--H--D--P--C--K--M--F--I--G--G--L--S--W--Q--T--T--Q--
ATGGAGACTGACGCGCCCCAGCCCGGCCTCGCCTCCCCGGACTCGCCGCACGACCCCTGCAAGATGTTCATCGGGGGACTCAGTTGGCAGACTACGCAGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

<--------------------------------------------------------------------------------><-----------------
E--G--L--R--E--Y--F--G--Q--F--G--E--V--K--E--C--L--V--M--R--D--P--L--T--K--R--S--R--G--F--G--F--V--T
AAGGGCTGCGCGAATACTTCGGCCAGTTCGGGGAGGTGAAGGAGTGTCTGGTGATGCGGGACCCCCTGACCAAGAGATCCAGGGGTTTCGGCTTCGTCAC
                                                                                   :::::::::::::::::
-----------------------------------------------------------------------------------GGTTTCGGCTTCGTCAC
------------------------------------------------------------------------------------G--F--G--F--V--T

------------------------------------------------------------------><--------------------------------
--F--M--D--Q--A--G--V--D--K--V--L--A--Q--S--R--H--E--L--D--S--K--T--I--D--P--K--V--A--F--P--R--R--A-
TTTCATGGACCAGGCGGGGGTGGATAAAGTGCTGGCGCAATCGCGGCACGAGCTCGACTCCAAAACAATTGACCCTAAGGTGGCCTTCCCTCGGCGAGCA
:: :.:::::::::::::::::::::::::.::::::::.:::::::::::::::::::::::::::                                 
TTGCGTGGACCAGGCGGGGGTGGATAAAGTACTGGCGCAGTCGCGGCACGAGCTCGACTCCAAAACA---------------------------------
--C--V--D--Q--A--G--V--D--K--V--L--A--Q--S--R--H--E--L--D--S--K--T----------------------------------

--------><------------------------------------------------------------------------------------------
-Q--P--K--M--V--T--R--T--K--K--I--F--V--G--G--L--S--V--N--T--T--V--E--D--V--K--Q--Y--F--E--Q--F--G--
CAGCCCAAGATGGTGACTCGAACGAAGAAGATCTTTGTGGGGGGGCTGTCGGTGAACACCACGGTGGAGGACGTGAAGCAATATTTTGAGCAGTTTGGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-><-----------------------------------------------><------------------------------------------------
K--V--D--D--A--M--L--M--F--D--K--T--T--N--R--H--R--G--F--G--F--V--T--F--E--S--E--D--I--V--E--K--V--C
AGGTGGACGACGCCATGCTGATGTTTGACAAAACCACCAACCGGCACCGAGGGTTCGGGTTTGTCACGTTTGAGAGTGAGGACATCGTGGAGAAAGTGTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------><-----------------------------------------------------------------
--E--I--H--F--H--E--I--N--N--K--M--V--E--C--K--K--A--Q--P--K--E--V--M--S--P--T--G--S--A--R--G--R--S-
TGAAATTCATTTTCATGAAATCAACAACAAAATGGTGGAATGTAAGAAAGCTCAGCCAAAGGAGGTGATGTCGCCAACGGGCTCAGCCCGGGGGAGGTCT
                                  ::::::::::::::::::::::::::.:::::::::::::::::.:::::.:::::::::::::::
----------------------------------GTGGAATGTAAGAAAGCTCAGCCAAAAGAGGTGATGTCGCCAACAGGCTCGGCCCGGGGGAGGTCT
-----------------------------------V--E--C--K--K--A--Q--P--K--E--V--M--S--P--T--G--S--A--R--G--R--S-

---------------------------------------------------><-----------------------------------------------
-R--V--M--P--Y--G--M--D--A--F--M--L--G--I--G--M--L--G--Y--P--G--F--Q--A--T--T--Y--A--S--R--S--Y--T--
CGAGTCATGCCCTACGGAATGGACGCCTTCATGCTGGGCATCGGCATGCTGGGTTACCCAGGTTTCCAAGCCACAACCTACGCCAGCCGGAGTTATACAG
:::::::::::::::::::::::::::::.:::::::::::::::::::::                                                 
CGAGTCATGCCCTACGGAATGGACGCCTTTATGCTGGGCATCGGCATGCTG-------------------------------------------------
-R--V--M--P--Y--G--M--D--A--F--M--L--G--I--G--M--L--------------------------------------------------

--------------------------------><-------------------------------------------------------><---------
G--L--A--P--G--Y--T--Y--Q--F--P--E--F--R--V--E--R--T--P--L--P--S--A--P--V--L--P--E--L--T--A--I--P--L
GCCTCGCCCCTGGCTACACCTACCAGTTCCCCGAATTCCGTGTAGAGCGGACCCCTCTCCCGAGCGCCCCAGTCCTCCCCGAGCTTACAGCCATTCCTCT
                                   ::::::::::::::::::::::::::::::::::::::::::::::::::::::           
-----------------------------------TTCCGTGTAGAGCGGACCCCTCTCCCGAGCGCCCCAGTCCTCCCCGAGCTTACA-----------
------------------------------------F--R--V--E--R--T--P--L--P--S--A--P--V--L--P--E--L--T------------

----------------------------------------------------------><----------------------------------------
--T--A--Y--G--P--M--A--A--A--A--A--A--A--A--V--V--R--G--T--G--S--H--P--W--T--M--A--P--P--P--G--S--T-
CACTGCCTACGGACCAATGGCGGCGGCAGCGGCGGCAGCGGCTGTGGTTCGAGGGACAGGCTCTCACCCCTGGACGATGGCTCCCCCTCCAGGTTCGACT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-P--S--R--T--G--G--F--L--G--T--T--S--P--G--P--M--A--E--L--Y--G--A--A--N--Q--D--S--G--V--S--S--Y--I--
CCCAGCCGCACAGGGGGCTTCCTGGGGACCACCAGCCCCGGCCCCATGGCCGAGCTCTACGGGGCGGCCAACCAGGACTCGGGGGTCAGCAGTTACATCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------><---------------------------------------->
S--A--A--S--P--A--P--S--T--G--F--G--H--S--L--G--G--P--L--I--A--T--A--F--T--N--G--Y--H--*-
GCGCCGCCAGCCCTGCCCCCAGCACCGGCTTCGGCCACAGTCTTGGGGGCCCTTTGATTGCCACAGCCTTCACCAATGGGTACCACTGA
                                                                                         
-----------------------------------------------------------------------------------------
-----------------------------------------------------------------------------------------

Pig Consensus Sequence

>BGISUST0000881556
----------------------------------------------------------------------------------------------------
-----------------------------------------------------------------------------------GGTTTCGGCTTCGTCAC
TTGCGTGGACCAGGCGGGGGTGGATAAAGTACTGGCGCAGTCGCGGCACGAGCTCGACTCCAAAACA---------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------GTGGAATGTAAGAAAGCTCAGCCAAAAGAGGTGATGTCGCCAACAGGCTCGGCCCGGGGGAGGTCT
CGAGTCATGCCCTACGGAATGGACGCCTTTATGCTGGGCATCGGCATGCTG-------------------------------------------------
-----------------------------------TTCCGTGTAGAGCGGACCCCTCTCCCGAGCGCCCCAGTCCTCCCCGAGCTTACA-----------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
-----------------------------------------------------------------------------------------


>BGISUSP0000881556
-------------------------------------------------------------GFGFVTCVDQAGVDKVLAQSRHELDSKT-----------
------------------------------------------------------------------------------VECKKAQPKEVMSPTGSARGRS
RVMPYGMDAFMLGIGML----------------------------FRVERTPLPSAPVLPELT-------------------------------------
---------------------------------------------------------------