Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000136327 (click for geneview)
Transcript ID ENST00000258829(link to ensembl)
Symbol NKX2-8
Localtion Chromosome:14:36118968:36121537:-1 band: 14q13.3
Description Homeobox protein Nkx-2.8 (Homeobox protein NK-2 homolog H). [Source:Uniprot/SWISSPROT;Acc:O15522]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--A--T--S--G--R--L--S--F--T--V--R--S--L--L--D--L--P--E--Q--D--A--Q--H--L--P--R--R--E--P--E--P--R--
ATGGCCACCTCTGGACGCCTGAGCTTCACCGTGCGCAGCCTTCTAGATTTACCCGAGCAGGACGCGCAACACCTGCCGAGGCGGGAGCCAGAACCACGCG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------><------------------------------------------
A--P--Q--P--D--P--C--A--A--W--L--D--S--E--R--G--H--Y--P--S--S--D--E--S--S--L--E--T--S--P--P--D--S--S
CCCCCCAGCCCGACCCCTGCGCCGCCTGGCTGGATTCGGAGCGCGGCCACTACCCTTCCTCGGACGAGAGCAGCCTGGAGACCAGCCCGCCAGACTCGTC
                                                           ::::::::::::::::..:::.::::::::: .:::::.::
-----------------------------------------------------------TCGGACGAGAGCAGCCCAGAGGCCAGCCCGCGGGACTCATC
------------------------------------------------------------S--D--E--S--S--P--E--A--S--P--R--D--S--S

----------------------------------------------------------------------------------------------------
--Q--R--P--S--A--R--P--A--S--P--G--S--D--A--E--K--R--K--K--R--R--V--L--F--S--K--A--Q--T--L--E--L--E-
GCAGCGGCCGTCCGCTAGGCCCGCGTCTCCGGGCTCGGACGCCGAGAAAAGGAAGAAGCGGCGGGTGCTATTCTCCAAGGCGCAGACGCTGGAGTTGGAG
:::.::::::::::::.::::.:::::::::.:::: ::.:: :::::.::::::::::::::::::::::::::::::::.::::::::::::::.:::
GCAACGGCCGTCCGCTGGGCCTGCGTCTCCGAGCTCCGATGCGGAGAAGAGGAAGAAGCGGCGGGTGCTATTCTCCAAGGCACAGACGCTGGAGTTAGAG
--Q--R--P--S--A--G--P--A--S--P--S--S--D--A--E--K--R--K--K--R--R--V--L--F--S--K--A--Q--T--L--E--L--E-

----------------------------------------------------------------------------------------------------
-R--R--F--R--Q--Q--R--Y--L--S--A--P--E--R--E--Q--L--A--S--L--L--R--L--T--P--T--Q--V--K--I--W--F--Q--
CGGCGCTTCCGGCAGCAGCGGTACCTGTCTGCGCCCGAGCGCGAGCAGCTGGCGAGCCTGCTTCGCCTCACGCCCACGCAGGTCAAGATCTGGTTCCAGA
:::::::::::::::::::: :::::::: ::::::::::: :::::::::::: ::::::: :::::::::::::::::::::::.:::::::::::::
CGGCGCTTCCGGCAGCAGCGCTACCTGTCAGCGCCCGAGCGGGAGCAGCTGGCGCGCCTGCTGCGCCTCACGCCCACGCAGGTCAAAATCTGGTTCCAGA
-R--R--F--R--Q--Q--R--Y--L--S--A--P--E--R--E--Q--L--A--R--L--L--R--L--T--P--T--Q--V--K--I--W--F--Q--

----------------------------------------------------------------------------------------------------
N--H--R--Y--K--L--K--R--A--R--A--P--G--A--A--E--S--P--D--L--A--A--S--A--E--L--H--A--A--P--G--L--L--R
ATCATCGCTACAAGCTGAAGCGCGCTCGCGCTCCAGGGGCGGCGGAGTCGCCTGACCTGGCAGCATCCGCCGAGCTGCACGCCGCGCCCGGCCTGCTGCG
:.::::::::::::::::::::::: ::::: ::.::::: :::::::::::.:::::::::::. :  ::::: :::.::::::::: :::::::::::
ACCATCGCTACAAGCTGAAGCGCGCGCGCGCGCCGGGGGCTGCGGAGTCGCCCGACCTGGCAGCGGCGTCCGAGGTGCGCGCCGCGCCGGGCCTGCTGCG
N--H--R--Y--K--L--K--R--A--R--A--P--G--A--A--E--S--P--D--L--A--A--A--S--E--V--R--A--A--P--G--L--L--R

----------------------------------------------------------------------------------------------------
--R--V--V--V--P--V--L--V--R--D--G--Q--P--C--G--G--G--G--G--G--E--V--G--T--A--A--A--Q--E--K--C--G--A-
TCGCGTGGTGGTGCCGGTGCTTGTTCGCGACGGGCAGCCGTGCGGCGGCGGCGGCGGTGGCGAGGTGGGAACCGCCGCGGCCCAGGAGAAGTGCGGCGCC
.:::::::::::::: ::::: :: ::::::::::::::::::::::: :::                                                
CCGCGTGGTGGTGCCCGTGCTGGTGCGCGACGGGCAGCCGTGCGGCGGAGGC------------------------------------------------
--R--V--V--V--P--V--L--V--R--D--G--Q--P--C--G--G--G-------------------------------------------------

----------------------------------------------------------------------------------------------------
-P--P--A--A--A--C--P--L--P--G--Y--P--A--F--G--P--G--S--A--L--G--L--F--P--A--Y--Q--H--L--A--S--P--A--
CCTCCAGCCGCCGCCTGCCCTCTGCCGGGCTACCCTGCCTTCGGTCCCGGCTCGGCGCTTGGCCTCTTCCCCGCCTACCAGCACTTAGCATCCCCCGCCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------->
L--V--S--W--N--W--*-
TGGTCTCCTGGAACTGGTGA
                    
--------------------
--------------------

Pig Consensus Sequence

>BGISUST0000888904
----------------------------------------------------------------------------------------------------
-----------------------------------------------------------TCGGACGAGAGCAGCCCAGAGGCCAGCCCGCGGGACTCATC
GCAACGGCCGTCCGCTGGGCCTGCGTCTCCGAGCTCCGATGCGGAGAAGAGGAAGAAGCGGCGGGTGCTATTCTCCAAGGCACAGACGCTGGAGTTAGAG
CGGCGCTTCCGGCAGCAGCGCTACCTGTCAGCGCCCGAGCGGGAGCAGCTGGCGCGCCTGCTGCGCCTCACGCCCACGCAGGTCAAAATCTGGTTCCAGA
ACCATCGCTACAAGCTGAAGCGCGCGCGCGCGCCGGGGGCTGCGGAGTCGCCCGACCTGGCAGCGGCGTCCGAGGTGCGCGCCGCGCCGGGCCTGCTGCG
CCGCGTGGTGGTGCCCGTGCTGGTGCGCGACGGGCAGCCGTGCGGCGGAGGC------------------------------------------------
----------------------------------------------------------------------------------------------------
--------------------


>BGISUSP0000888904
-----------------------------------------------------SDESSPEASPRDSSQRPSAGPASPSSDAEKRKKRRVLFSKAQTLELE
RRFRQQRYLSAPEREQLARLLRLTPTQVKIWFQNHRYKLKRARAPGAAESPDLAAASEVRAAPGLLRRVVVPVLVRDGQPCGGG----------------
----------------------------------------