Sequences
EST Library Info
ecc1Foetus 50 days, cortex cerebri
nbm1Newborn 115 days, bone marrow (pelvis)
Clusters
Oligos
SNPs

Gene ID ENSG00000137310 (click for geneview)
Transcript ID ENST00000259844(link to ensembl)
Symbol NP_009040.1
Localtion Chromosome:6:31234385:31239970:1 band: 6p21.33
Description transcription factor 19 (SC1)
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--L--P--C--F--Q--L--L--R--I--G--G--G--R--G--G--D--L--Y--T--F--H--P--P--A--G--A--G--C--T--Y--R--L--
ATGCTGCCCTGCTTCCAACTGCTGCGCATAGGGGGCGGCAGGGGCGGTGATCTCTACACCTTCCACCCCCCCGCCGGGGCTGGCTGCACCTATCGCTTGG
:::::::::::::::::.:: :::::::::::::::::::::::.: .::.::.::::::::::::::::: . .:::::::::::::::::.:::::::
ATGCTGCCCTGCTTCCAGCTCCTGCGCATAGGGGGCGGCAGGGGTGTCGACCTTTACACCTTCCACCCCCCAAGTGGGGCTGGCTGCACCTACCGCTTGG
-M--L--P--C--F--Q--L--L--R--I--G--G--G--R--G--V--D--L--Y--T--F--H--P--P--S--G--A--G--C--T--Y--R--L--

----------------------------------------------------------------------------------------------------
G--H--R--A--D--L--C--D--V--A--L--R--P--Q--Q--E--P--G--L--I--S--G--I--H--A--E--L--H--A--E--P--R--G--D
GCCACAGGGCCGACCTGTGTGATGTGGCCCTGCGGCCCCAGCAGGAGCCTGGCCTCATCTCTGGGATCCACGCCGAACTGCATGCCGAGCCCCGGGGTGA
::..:::::::::::::::::::::::::::::::::::::::::::::.:::.::::::: :...::::::: ::.:::::.::.:::: :::::::::
GCTGCAGGGCCGACCTGTGTGATGTGGCCCTGCGGCCCCAGCAGGAGCCCGGCTTCATCTCGGAAGTCCACGCGGAGCTGCACGCTGAGCGCCGGGGTGA
G--C--R--A--D--L--C--D--V--A--L--R--P--Q--Q--E--P--G--F--I--S--E--V--H--A--E--L--H--A--E--R--R--G--D

-------------------------------------><-------------------------------------------------------------
--D--W--R--V--S--L--E--D--H--S--S--Q--G--T--L--V--N--N--V--R--L--P--R--G--H--R--L--E--L--S--D--G--D-
TGACTGGAGGGTCAGCCTGGAAGACCACAGCAGCCAAGGTACTTTGGTCAATAATGTCCGACTCCCAAGAGGTCACAGGCTGGAATTGAGTGATGGAGAC
:::::::::::::::::::::.:::::.:::::::::                                                               
TGACTGGAGGGTCAGCCTGGAGGACCATAGCAGCCAA---------------------------------------------------------------
--D--W--R--V--S--L--E--D--H--S--S--Q----------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-L--L--T--F--G--P--E--G--P--P--G--T--S--P--S--E--F--Y--F--M--F--Q--Q--V--R--V--K--P--Q--D--F--A--A--
CTCCTGACCTTTGGCCCTGAAGGGCCCCCAGGAACCAGCCCCTCGGAGTTCTACTTCATGTTCCAACAAGTACGAGTCAAGCCTCAGGACTTTGCTGCCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
I--T--I--P--R--S--R--G--E--A--R--V--G--A--G--F--R--P--M--L--P--S--Q--G--A--P--Q--R--P--L--S--T--F--S
TTACCATCCCACGGTCTAGGGGAGAAGCCCGGGTTGGGGCTGGTTTCCGGCCTATGCTGCCCTCCCAGGGGGCTCCACAGCGGCCTCTCAGCACCTTCTC
                                      ::::::::::::::::::::::::::::: :::::.:: ::::: ::.:::::::::.::::
--------------------------------------GCTGGTTTCCGGCCTATGCTGCCCTCCCA-GGGGCCCCCCAGCGCCCCCTCAGCACCCTCTC
---------------------------------------A--G--F--R--P--M--L--P--S--Q--G--A--P--Q--R--P--L--S--T--L--S

----------------------------------------------------------------------------------------------------
--P--A--P--K--A--T--L--I--L--N--S--I--G--S--L--S--K--L--R--P--Q--P--L--T--F--S--P--S--W--G--G--P--K-
CCCTGCCCCCAAGGCCACACTGATCCTAAACTCCATAGGCAGCCTCAGCAAGCTCCGGCCCCAGCCCCTCACCTTCTCCCCTAGTTGGGGTGGACCAAAG
:::..:::::::.::::: :::::::: :::::::: :::::::::::::::::::. .. ::::: ::::: :::::.:  ::: ::.::::.::. ::
CCCCACCCCCAAAGCCACCCTGATCCTCAACTCCATCGGCAGCCTCAGCAAGCTCCACTTGCAGCCGCTCACATTCTCTCGGAGTGGGAGTGGGCCGCAG
--P--T--P--K--A--T--L--I--L--N--S--I--G--S--L--S--K--L--H--L--Q--P--L--T--F--S--R--S--G--S--G--P--Q-

----------------------------------------------------------------------------------------------------
-S--L--P--V--P--A--P--P--G--E--M--G--T--T--P--S--A--P--P--Q--R--N--R--R--K--S--V--H--R--V--L--A--E--
AGCCTGCCTGTTCCCGCCCCACCTGGGGAAATGGGGACCACGCCTTCTGCTCCACCACAACGCAATCGGAGGAAATCTGTTCACCGAGTGTTGGCGGAAC
:..:..::.:::.::.:  : :::::::::.::.::::::: ::::: ::.::::: : : : ::.:::::::::::.:.:::::: ::::::::.::::
AATCCACCCGTTTCCACGACTCCTGGGGAAGTGAGGACCACCCCTTCGGCCCCACCCCCAAGAAACCGGAGGAAATCCGCTCACCGCGTGTTGGCAGAAC
-N--P--P--V--S--T--T--P--G--E--V--R--T--T--P--S--A--P--P--P--R--N--R--R--K--S--A--H--R--V--L--A--E--

----------------------------------------------------------------------------------------------------
L--D--D--E--S--E--P--P--E--N--P--P--P--V--L--M--E--P--R--K--K--L-----R--V--D--K--A--P--L--T--P--T--G
TGGATGATGAGAGTGAGCCTCCTGAGAACCCGCCACCGGTCCTTATGGAGCCCAGGAAGAAACTC---CGTGTAGACAAAGCCCCACTGACTCCCACTGG
::::.:::::::: ::: ::::.::::.::. ::::: :: :::::.:::::::::::::::::    :::::::: :::.::::::.::: :::     
TGGACGATGAGAGAGAGGCTCCCGAGAGCCTCCCACCCGTGCTTATAGAGCCCAGGAAGAAACTGCTCCGTGTAGAGAAAACCCCACCGACACCC-----
L--D--D--E--R--E--A--P--E--S--L--P--P--V--L--I--E--P--R--K--K--L--L--R--V--E--K--T--P--P--T--P------

--><--------------------------------------------------------------><--------------------------------
--N--R--R--G--R--P--R--K--Y--P--V--S--A--P--M--A--P--P--A--V--G--G--S--P--V--Q--L--L--V--A--A--C--P-
AAATCGACGTGGCCGTCCTCGGAAGTACCCAGTGAGCGCTCCCATGGCTCCCCCTGCAGTTGGGGGGAGCCCTGTGCAGCTCCTTGTTGCTGCCTGCCCC
                                                                ::::::::::::::::.::.:::::::::::.::::
----------------------------------------------------------------GGGAGCCCTGTGCAGCCCCCTGTTGCTGCCTACCCC
-----------------------------------------------------------------G--S--P--V--Q--P--P--V--A--A--Y--P-

----------------------------------------------------------------------------------------------------
-R--K--R--Q--W--P--G--F--S--V--M--A--V--T--S--G--S--M--W--P--V--L--A--A--A--S--R--L--P--G--R--P--T--
AGGAAGAGACAGTGGCCTGGGTTCAGTGTGATGGCTGTGACGTCTGGTTCCATGTGGCCTGTGTTGGCTGCAGCATCCAGGCTGCCAGGGAGGCCGACTT
:.:::::::::::.::.:::::::::::::::::.::::::..::::::::::::::::::::::::::::::::::::::::::::.:::.::.:::::
AAGAAGAGACAGTAGCTTGGGTTCAGTGTGATGGTTGTGACACCTGGTTCCATGTGGCCTGTGTTGGCTGCAGCATCCAGGCTGCCAAGGAAGCTGACTT
-K--K--R--Q--*--L--G--F--S--V--M--V--V--T--P--G--S--M--W--P--V--L--A--A--A--S--R--L--P--R--K--L--T--

-------------------------------><--------------------------------------------
S--D--A--Q--G--A--G--L--A--F--L--R--S--T--A--K--A--P--S--D--T--P--A--H--E--*-
CCGATGCCCAGGGTGCCGGGCTGGCATTCCTAAGGTCCACTGCCAAGGCACCATCGGACACACCTGCCCATGAGTAG
:::.:::::::: ::::                                                            
CCGGTGCCCAGGCTGCC------------------------------------------------------------
S--G--A--Q--A--A-------------------------------------------------------------

Pig Consensus Sequence

>BGISUST0000885425
ATGCTGCCCTGCTTCCAGCTCCTGCGCATAGGGGGCGGCAGGGGTGTCGACCTTTACACCTTCCACCCCCCAAGTGGGGCTGGCTGCACCTACCGCTTGG
GCTGCAGGGCCGACCTGTGTGATGTGGCCCTGCGGCCCCAGCAGGAGCCCGGCTTCATCTCGGAAGTCCACGCGGAGCTGCACGCTGAGCGCCGGGGTGA
TGACTGGAGGGTCAGCCTGGAGGACCATAGCAGCCAA---------------------------------------------------------------
----------------------------------------------------------------------------------------------------
--------------------------------------GCTGGTTTCCGGCCTATGCTGCCCTCcgGGGCCCCCCAGCGCCCCCTCAGCACCCTCTCCCC
CACCCCCAAAGCCACCCTGATCCTCAACTCCATCGGCAGCCTCAGCAAGCTCCACTTGCAGCCGCTCACATTCTCTCGGAGTGGGAGTGGGCCGCAGAAT
CCACCCGTTTCCACGACTCCTGGGGAAGTGAGGACCACCCCTTCGGCCCCACCCCCAAGAAACCGGAGGAAATCCGCTCACCGCGTGTTGGCAGAACTGG
ACGATGAGAGAGAGGCTCCCGAGAGCCTCCCACCCGTGCTTATAGAGCCCAGGAAGAAACTGCTCCGTGTAGAGAAAACCCCACCGACA-----------
----------------------------------------------------------GGGAGCCCTGTGCAGCCCCCTGTTGCTGCCTACCCCAAGAAG
AGACAGTAGCTTGGGTTCAGTGTGATGGTTGTGACACCTGGTTCCATGTGGCCTGTGTTGGCTGCAGCATCCAGGCTGCCAAGGAAGCTGACTTCCGGTG
CCCAGGCTGCC------------------------------------------------------------


>BGISUSP0000885425
MLPCFQLLRIGGGRGVDLYTFHPPSGAGCTYRLGCRADLCDVALRPQQEPGFISEVHAELHAERRGDDWRVSLEDHSSQ---------------------
----------------------------------------------AGFRPMLPSGAPQRPLSTLSPTPKATLILNSIGSLSKLHLQPLTFSRSGSGPQN
PPVSTTPGEVRTTPSAPPPRNRRKSAHRVLAELDDEREAPESLPPVLIEPRKKLLRVEKTPPT-----------------------GSPVQPPVAAYPKK
RQ*LGFSVMVVTPGSMWPVLAAASRLPRKLTSGAQAA--------------------