Sequences
EST Library Info
ton1Tip of tongue, mucosal membrane
Clusters
Oligos
SNPs

Gene ID ENSG00000137327 (click for geneview)
Transcript ID ENST00000259870(link to ensembl)
Symbol NP_054789.1
Localtion Chromosome:6:31186982:31188315:-1 band: 6p21.33
Description STG protein [Source:RefSeq_peptide;Acc:NP_054789]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-----------------------------------------------------------------><--------------------------------
-M--Q--G--R--V--A--G--S--C--A--P--L--G--L--L--L--V--C--L--H--L--P--G--L--F--A--R--S--I--G--V--V--E--
ATGCAGGGCCGCGTGGCAGGGAGCTGCGCTCCTCTGGGCCTGCTCCTGGTCTGTCTTCATCTCCCAGGCCTCTTTGCCCGGAGCATCGGTGTTGTGGAGG
      ::. :: ::::.:::::::: ::::::::::::::::::::::.::::::::::::::::                                  
------GGTGGCCTGGCGGGGAGCTGGGCTCCTCTGGGCCTGCTCCTGGCCTGTCTTCATCTCCCA----------------------------------
-------G--G--L--A--G--S--W--A--P--L--G--L--L--L--A--C--L--H--L--P-----------------------------------

----------------------------------------------------------------------------------------------------
E--K--V--S--Q--N--L--G--T--N--L--P--Q--L--G--Q--P--S--S--T--G--P--S--N--S--E--H--P--Q--P--A--L--D--P
AGAAAGTTTCCCAAAACTTGGGGACCAACTTGCCTCAGCTCGGACAACCTTCCTCCACTGGCCCCTCTAACTCTGAACATCCGCAGCCCGCTCTGGACCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--R--S--N--D--L--A--R--V--P--L--K--L--S--V--P--A--S--D--G--F--P--P--A--G--G--S--A--V--Q--R--W--P--P-
TAGGTCTAATGACTTGGCAAGGGTTCCTCTGAAGCTCAGCGTGCCTGCATCAGATGGCTTCCCACCTGCAGGAGGTTCTGCAGTGCAGAGGTGGCCTCCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-S--W--G--L--P--A--M--D--S--W--P--P--E--D--P--W--Q--M--M--A--A--A--A--E--D--R--L--G--E--A--L--P--E--
TCGTGGGGGCTGCCTGCCATGGATTCCTGGCCCCCTGAGGATCCTTGGCAGATGATGGCTGCTGCGGCTGAGGACCGCCTGGGGGAAGCGCTGCCTGAAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
E--L--S--Y--L--S--S--A--A--A--L--A--P--G--S--G--P--L--P--G--E--S--S--P--D--A--T--G--L--S--P--K--A--S
AACTCTCTTACCTCTCCAGTGCTGCGGCCCTCGCTCCGGGCAGTGGCCCTTTGCCTGGGGAGTCTTCTCCCGATGCCACAGGCCTCTCACCCAAGGCTTC
                                                                                      ::. ::.:::::::
--------------------------------------------------------------------------------------TCGGCCGAGGCTTC
---------------------------------------------------------------------------------------S--A--E--A--S

----------------------------------------------------------------------------------------------------
--L--L--H--Q--D--S--E--S--R--R--L--P--R--S--N--S--L--G--A--G--G--K--I--L--S--Q--R--P--P--W--S--L--I-
ACTCCTCCACCAGGACTCGGAGTCCAGACGACTGCCCCGTTCTAATTCACTGGGAGCCGGGGGAAAAATCCTTTCCCAACGCCCTCCCTGGTCTCTCATC
:::::::::::::::::: :::::. ::::.::.:::::: ::::. ..::::::::: :::::.:::::::: :::.::.::: :.:::::::::::::
ACTCCTCCACCAGGACTCCGAGTCTCGACGGCTACCCCGTGCTAACGTGCTGGGAGCCCGGGGAGAAATCCTTGCCCGACACCCACTCTGGTCTCTCATC
--L--L--H--Q--D--S--E--S--R--R--L--P--R--A--N--V--L--G--A--R--G--E--I--L--A--R--H--P--L--W--S--L--I-

----------------------------------------------------------------------------------------------------
-H--R--V--------------L--P--D--H--P--W--G--T--L--N--P--S--V--S--W--G--G--G--G--P--G--T--G--W--G--T--
CACAGGGTT------------CTGCCTGATCACCCCTGGGGTACCCTGAATCCCAGTGTGTCCTGGGGAGGTGGAGGCCCTGGGACTGGTTGGGGAACGA
 :::::.::            :::::::.:.:::::::::: :::::::.:::::::::::::::::::::::::::.:::::.::::: ::::: ::.:
AACAGGATTCGACGGCCATTTCTGCCTGGTTACCCCTGGGGGACCCTGAGTCCCAGTGTGTCCTGGGGAGGTGGAGGTCCTGGAACTGGATGGGGCACAA
-N--R--I--R--R--P--F--L--P--G--Y--P--W--G--T--L--S--P--S--V--S--W--G--G--G--G--P--G--T--G--W--G--T--

----------------------------------------------------------------------------------------------------
R--P--M--P--H--P--E--G--I--W--G--I--N--N--Q--P--P--G--T--S--W--G--N--I--N--R--Y--P--G--G--S--W--G--N
GGCCCATGCCACACCCTGAGGGAATCTGGGGTATCAATAATCAACCCCCAGGTACCAGCTGGGGAAATATTAATCGGTATCCAGGAGGCAGCTGGGGAAA
:::::::::::.:::::: ::::: :::::::: ::..::::::. ::::.::::.::::::::.: .::::::::.::.::::: . :::::::::.::
GGCCCATGCCATACCCTGTGGGAAGCTGGGGTAACAGCAATCAATACCCAAGTACTAGCTGGGGGACCATTAATCGATACCCAGGTATCAGCTGGGGGAA
R--P--M--P--Y--P--V--G--S--W--G--N--S--N--Q--Y--P--S--T--S--W--G--T--I--N--R--Y--P--G--I--S--W--G--N

----------------------------------------------------------------------------------------------------
--I--N--R--Y--P--G--G--S--W--G--N--I--N--R--Y--P--G--G--S--W--G--N--I--H--L--Y--P--G--I--N--N--P--F-
TATTAATCGGTATCCAGGAGGCAGCTGGGGGAATATTAATCGGTATCCAGGAGGCAGCTGGGGGAATATTCATCTATACCCAGGTATCAATAACCCATTT
:::.  ::::::.:::                                                                                    
TATCCTTCGGTACCCA------------------------------------------------------------------------------------
--I--L--R--Y--P-------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------->
-P--P--G--V--L--R--P--P--G--S--S--W--N--I--P--A--G--F--P--N--P--P--S--P--R--L--Q--W--G--*-
CCTCCTGGAGTCCTCCGCCCTCCTGGCTCTTCTTGGAACATCCCAGCTGGCTTCCCTAATCCTCCAAGCCCTAGGTTGCAGTGGGGCTAG
                                                                                          
------------------------------------------------------------------------------------------
------------------------------------------------------------------------------------------

Pig Consensus Sequence

>BGISUST0000891349
------GGTGGCCTGGCGGGGAGCTGGGCTCCTCTGGGCCTGCTCCTGGCCTGTCTTCATCTCCCA----------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
--------------------------------------------------------------------------------------TCGGCCGAGGCTTC
ACTCCTCCACCAGGACTCCGAGTCTCGACGGCTACCCCGTGCTAACGTGCTGGGAGCCCGGGGAGAAATCCTTGCCCGACACCCACTCTGGTCTCTCATC
AACAGGATTCGACGGCCATTTCTGCCTGGTTACCCCTGGGGGACCCTGAGTCCCAGTGTGTCCTGGGGAGGTGGAGGTCCTGGAACTGGATGGGGCACAA
GGCCCATGCCATACCCTGTGGGAAGCTGGGGTAACAGCAATCAATACCCAAGTACTAGCTGGGGGACCATTAATCGATACCCAGGTATCAGCTGGGGGAA
TATC------------------------------------------------------------------------------------------------
------------------------------------------------------------------------------


>BGISUSP0000891349
--GGLAGSWAPLGLLLACLHLP------------------------------------------------------------------------------
--------------------------------------------------------------SAEASLLHQDSESRRLPRANVLGARGEILARHPLWSLI
NRIRRPFLPGYPWGTLSPSVSWGGGGPGTGWGTRPMPYPVGSWGNSNQYPSTSWGTINRYPGISWGNI--------------------------------
--------------------------