Sequences
CT229534reads
CT314646reads
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000184824 (click for geneview)
Transcript ID ENST00000260285(link to ensembl)
Localtion Chromosome:11:118716836:118722580:-1 band: 11q23.3
Description Complement C1q tumor necrosis factor-related protein 5 precursor. [Source:Uniprot/SWISSPROT;Acc:Q9BXJ0]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<----------------------------------------------------><---------------------------------------------
-M--K--D--F--S--D--V--I--L--C--M--E--A--T--E--S--S--K--T--E--F--C--N--P--A--F--E--P--E--S--G--P--P--
ATGAAGGACTTCTCAGATGTCATCCTCTGCATGGAGGCAACAGAATCGAGCAAGACCGAGTTCTGCAATCCTGCCTTCGAGCCTGAGTCTGGGCCACCCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------><------------------------------------------
C--P--P--P--V--F--P--E--D--A--S--Y--S--V--P--A--P--W--H--G--R--R--P--R--G--L--R--P--D--C--R--F--S--W
GCCCTCCCCCAGTTTTCCCAGAGGATGCCAGCTACAGCGTCCCAGCTCCCTGGCATGGTCGGCGTCCTCGAGGGCTACGGCCAGACTGCCGCTTCTCCTG
                                                           :.:::.::.::::::::.:.:::::::::::::::::::::
-----------------------------------------------------------CAGCGCCCCCGAGGGCTGCAGCCAGACTGCCGCTTCTCCTG
------------------------------------------------------------Q--R--P--R--G--L--Q--P--D--C--R--F--S--W

----------------------------------------------------------------------><----------------------------
--L--C--V--L--L--L--S--S--L--L--L--L--L--L--G--L--L--V--A--I--I--L--A--Q--L--Q--A--A--P--P--S--G--A-
GCTCTGTGTCCTCCTGCTCTCCAGCCTGCTCCTCCTGCTGCTTGGGCTGCTGGTGGCCATCATCCTGGCCCAGCTGCAGGCTGCACCCCCATCTGGGGCG
::: ::::::::::::::  :::::::::: :::::::::::.:::::::::::::::::::::::::::                              
GCTGTGTGTCCTCCTGCTGGCCAGCCTGCTGCTCCTGCTGCTCGGGCTGCTGGTGGCCATCATCCTGGCC------------------------------
--L--C--V--L--L--L--A--S--L--L--L--L--L--L--G--L--L--V--A--I--I--L--A-------------------------------

----------------------------------------------------------------------------------------------------
-S--H--S--P--L--P--A--G--G--L--T--T--T--T--T--T--P--T--I--T--T--S--Q--A--A--G--T--P--K--G--Q--Q--E--
TCCCATAGCCCACTGCCTGCCGGAGGCCTTACCACGACCACCACCACCCCCACCATCACCACCTCTCAGGCAGCTGGGACCCCTAAAGGGCAGCAGGAGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------><------------------------------------------------------------------------
S--G--V--S--P--S--P--Q--S--T--C--G--G--L--L--S--G--P--R--G--F--F--S--S--P--N--Y--P--D--P--Y--P--P--N
CAGGCGTGAGCCCCTCCCCACAGTCCACCTGTGGAGGCCTCCTCTCTGGCCCAAGGGGCTTCTTCAGCAGCCCTAACTACCCAGACCCTTACCCCCCCAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--T--H--C--V--W--H--I--Q--V--A--T--D--H--A--I--Q--L--K--I--E--A--L--S--I--E--S--V--A--S--C--L--F--D-
CACCCACTGCGTGTGGCATATCCAGGTGGCCACAGACCATGCAATACAGCTCAAGATCGAAGCCCTCAGCATAGAGAGTGTGGCCTCTTGCCTTTTTGAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------><----------------------------------------------------------
-R--L--E--L--S--P--E--P--E--G--P--L--L--R--V--C--G--R--V--P--P--P--T--L--N--T--N--A--S--H--L--L--V--
CGCTTGGAACTCTCCCCTGAGCCTGAAGGCCCCCTCCTCAGGGTTTGTGGAAGGGTGCCTCCCCCCACGCTCAACACCAATGCCAGCCACCTCCTGGTGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------------------------------><-----------------------
V--F--V--S--D--S--S--V--E--G--F--G--F--H--A--W--Y--Q--A--M--A--P--G--R--G--D--C--A--H--D--E--F--R--C
TCTTCGTCTCTGACAGCAGTGTGGAAGGATTTGGTTTCCATGCCTGGTACCAGGCTATGGCCCCTGGGCGCGGTGACTGTGCCCATGATGAGTTCCGCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------------------------------------------><-
--D--Q--L--I--C--L--L--P--D--S--V--C--D--G--F--A--N--C--A--D--G--S--D--E--T--N--C--S--A--K--F--S--G-
TGACCAGCTCATCTGCCTGCTACCTGACTCAGTGTGTGATGGTTTTGCCAACTGTGCTGACGGCAGTGATGAGACCAATTGCAGTGCCAAGTTCTCGGGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------><------------------------
-C--G--G--N--L--T--G--L--Q--G--T--F--S--T--P--S--Y--L--Q--Q--Y--P--H--Q--L--L--C--T--W--H--I--S--V--
TGTGGGGGGAATCTGACTGGCCTCCAGGGCACTTTCTCTACTCCCAGCTACCTGCAGCAGTACCCTCACCAACTGCTCTGCACCTGGCATATCTCGGTGC
                                                                           ::.:::::::::::::::::.::::
---------------------------------------------------------------------------CTTTGCACCTGGCATATCTCAGTGC
----------------------------------------------------------------------------L--C--T--W--H--I--S--V--

----------------------------------------------------------------------------------------------------
P--A--G--H--S--I--E--L--Q--F--H--N--F--S--L--E--A--Q--D--E--C--K--F--D--Y--V--E--V--Y--E--T--S--S--S
CTGCCGGACACAGCATAGAACTACAGTTCCACAACTTCAGCCTGGAGGCTCAGGACGAGTGCAAGTTTGACTACGTGGAGGTGTATGAGACCAGCAGCTC
:.::.:::::..::::::::::.:::::.::::::::::::::::: .::::::::: :::::::::::::::.:::::.:: :::::::::::::.:::
CCGCTGGACATGGCATAGAACTGCAGTTTCACAACTTCAGCCTGGACACTCAGGACGCGTGCAAGTTTGACTATGTGGAAGTTTATGAGACCAGCAACTC
P--A--G--H--G--I--E--L--Q--F--H--N--F--S--L--D--T--Q--D--A--C--K--F--D--Y--V--E--V--Y--E--T--S--N--S

-----------------------><---------------------------------------------------------------------------
--G--A--F--S--L--L--G--R--F--C--G--A--E--P--P--P--H-----L--V--S--S--H--H--E--L--A--V--L--F--R--T--D-
AGGGGCCTTCAGCCTCCTGGGCAGGTTCTGTGGAGCAGAGCCACCCCCCCAC---CTCGTCTCCTCGCACCATGAGCTGGCTGTGCTGTTTAGGACAGAT
:::::::.::::::::::::::   ::::::::::::::.::.:: ::::.    :::.::::::::.::::. :::::::::: :: ::::::::::::
AGGGGCCCTCAGCCTCCTGGGC---TTCTGTGGAGCAGAACCGCCACCCCGGCGCCTCATCTCCTCGTACCACCAGCTGGCTGTCCTTTTTAGGACAGAT
--G--A--L--S--L--L--G-----F--C--G--A--E--P--P--P--R--R--L--I--S--S--Y--H--Q--L--A--V--L--F--R--T--D-

---------------------------------------------------------><-----------------------------------------
-H--G--I--S--S--G--G--F--S--A--T--Y--L--A--F--N--A--T--E--N--P--C--G--P--S--E--L--S--C--Q--A--G--G--
CATGGCATCAGCAGTGGAGGCTTCTCAGCCACCTACCTGGCCTTCAATGCCACGGAGAACCCCTGTGGGCCCAGTGAGCTCTCCTGCCAGGCAGGAGGGT
::::::::::::.::::.::::::                                                                            
CATGGCATCAGCGGTGGGGGCTTC----------------------------------------------------------------------------
-H--G--I--S--G--G--G--F-----------------------------------------------------------------------------

-----------------------------------------------------------------------------------------><---------
C--K--G--V--Q--W--M--C--D--M--W--R--D--C--T--D--G--S--D--D--N--C--S--G--P--L--F--P--P--P--E--L--A--C
GTAAGGGTGTGCAGTGGATGTGTGACATGTGGAGAGACTGCACCGATGGCAGCGATGACAACTGCAGCGGCCCCTTGTTCCCACCCCCAGAGCTGGCCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--E--P--V--Q--V--E--M--C--L--G--L--S--Y--N--T--T--A--F--P--N--I--W--V--G--M--I--T--Q--E--E--V--V--E-
TGAGCCTGTCCAGGTGGAGATGTGCCTCGGTCTGAGCTACAACACCACAGCCTTCCCTAACATCTGGGTGGGCATGATCACCCAGGAGGAGGTGGTAGAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------><---------------------------------------------------------------------------------
-V--L--S--G--Y--K--S--L--T--S--L--P--C--Y--Q--H--F--R--R--L--L--C--G--L--L--V--P--R--C--T--P--L--G--
GTCCTCAGCGGTTACAAGAGCCTGACAAGCCTGCCCTGCTACCAGCATTTCCGGAGGCTCCTGTGTGGGCTGCTTGTGCCCCGTTGCACCCCACTAGGCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
S--V--L--P--P--C--R--S--V--C--Q--E--A--E--H--Q--C--Q--S--G--L--A--L--L--G--T--P--W--P--F--N--C--N--R
GTGTTCTGCCCCCTTGCCGCTCTGTCTGCCAGGAAGCGGAGCACCAGTGCCAGTCTGGCCTGGCACTACTGGGCACCCCCTGGCCCTTCAACTGCAACAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------>
--L--P--E--A--A--D--L--E--A--C--A--Q--P--*-
GCTGCCAGAGGCAGCTGACCTGGAAGCTTGTGCCCAGCCCTGA
                                           
-------------------------------------------
-------------------------------------------

Pig Consensus Sequence

>BGISUST0000898361
----------------------------------------------------------------------------------------------------
-----------------------------------------------------------CAGCGCCCCCGAGGGCTGCAGCCAGACTGCCGCTTCTCCTG
GCTGTGTGTCCTCCTGCTGGCCAGCCTGCTGCTCCTGCTGCTCGGGCTGCTGGTGGCCATCATCCTGGCC------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
---------------------------------------------------------------------------CTTTGCACCTGGCATATCTCAGTGC
CCGCTGGACATGGCATAGAACTGCAGTTTCACAACTTCAGCCTGGACACTCAGGACGCGTGCAAGTTTGACTATGTGGAAGTTTATGAGACCAGCAACTC
AGGGGCCCTCAGCCTCCTGGGC---TTCTGTGGAGCAGAACCGCCACCCCGGCGCCTCATCTCCTCGTACCACCAGCTGGCTGTCCTTTTTAGGACAGAT
CATGGCATCAGCGGTGGGGGC-------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------


>BGISUSP0000898361
-----------------------------------------------------QRPRGLQPDCRFSWLCVLLLASLLLLLLGLLVAIILA----------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
-------------------------LCTWHISVPAGHGIELQFHNFSLDTQDACKFDYVEVYETSNSGALSLLG-FCGAEPPPRRLISSYHQLAVLFRTD
HGISGGG---------------------------------------------------------------------------------------------
--------------------------------------------------------------------------------