Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000137875 (click for geneview)
Transcript ID ENST00000260442(link to ensembl)
Symbol BCL2L10
Localtion Chromosome:15:50189120:50192264:-1 band: 15q21.2
Description Apoptosis regulator Bcl-B (Bcl-2-like 10 protein) (Anti-apoptotic protein NrH). [Source:Uniprot/SWISSPROT;Acc:Q9HD36]
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--V--D--Q--L--R--E--R--T--T--M--A--D--P--L--R--E--R--T--E--L--L--L--A--D--Y--L--G--Y--C--A--R--E--
ATGGTTGACCAGTTGCGGGAGCGCACCACCATGGCCGACCCGCTGCGGGAGCGCACCGAGCTGTTGCTGGCCGACTACCTGGGGTACTGCGCCCGGGAAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
P--G--T--P--E--P--A--P--S--T--P--E--A--A--V--L--R--S--A--A--A--R--L--R--Q--I--H--R--S--F--F--S--A--Y
CCGGCACCCCCGAGCCGGCGCCATCCACGCCCGAGGCCGCCGTGCTGCGCTCCGCGGCCGCCAGGTTACGGCAGATTCACCGGTCCTTTTTCTCCGCCTA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--L--G--Y--P--G--N--R--F--E--L--V--A--L--M--A--D--S--V--L--S--D--S--P--G--P--T--W--G--R--V--V--T--L-
CCTCGGCTACCCCGGGAACCGCTTCGAGCTGGTGGCGCTGATGGCGGATTCCGTGCTCTCCGACAGCCCCGGCCCCACCTGGGGCAGAGTGGTGACGCTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-V--T--F--A--G--T--L--L--E--R--G--P--L--V--T--A--R--W--K--K--W--G--F--Q--P--R--L--K--E--Q--E--G--D--
GTGACCTTCGCAGGGACGCTGCTGGAGAGAGGGCCGCTGGTGACCGCCCGGTGGAAGAAGTGGGGCTTCCAGCCGCGGCTAAAGGAGCAGGAGGGCGACG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------><----------
V--A--R--D--C--Q--R--L--V--A--L--L--S--S--R--L--M--G--Q--H--R--A--W--L--Q--A--Q--G--G--W--D--G--F--C
TCGCCCGGGACTGCCAGCGCCTGGTGGCCTTGCTGAGCTCGCGGCTCATGGGGCAGCACCGCGCCTGGCTGCAGGCTCAGGGCGGCTGGGATGGCTTTTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--H--F--F--R--T--P--F--P--L--A--F--W--R--K--Q--L--V--Q--A--F--L--S--C--L--L--T--T--A--F--I--Y--L--W-
TCACTTCTTCAGGACCCCCTTTCCACTGGCTTTTTGGAGAAAACAGCTGGTCCAGGCTTTTCTGTCATGCTTGTTAACAACAGCCTTCATTTATCTCTGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------->
-T--R--L--L--*-
ACACGATTATTATGA
               
---------------
---------------