Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000119715 (click for geneview)
Transcript ID ENST00000261532(link to ensembl)
Symbol ESRRB
Localtion Chromosome:14:75975450:76035978:1 band: 14q24.3
Description Steroid hormone receptor ERR2 (Estrogen-related receptor, beta) (ERR- beta) (Estrogen receptor-like 2) (ERR beta-2). [Source:Uniprot/SWISSPROT;Acc:O95718]
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--S--S--D--D--R--H--L--G--S--S--C--G--S--F--I--K--T--E--P--S--S--P--S--S--G--I--D--A--L--S--H--H--
ATGTCCTCGGACGACAGGCACCTGGGCTCCAGCTGCGGCTCCTTCATCAAGACTGAGCCGTCCAGCCCGTCCTCGGGCATCGATGCCCTCAGCCACCACA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
S--P--S--G--S--S--D--A--S--G--G--F--G--L--A--L--G--T--H--A--N--G--L--D--S--P--P--M--F--A--G--A--G--L
GCCCCAGTGGCTCGTCCGACGCCAGCGGCGGCTTTGGCCTGGCCCTGGGCACCCACGCCAACGGTCTGGACTCGCCACCCATGTTTGCAGGCGCCGGGCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--G--G--T--P--C--R--K--S--Y--E--D--C--A--S--G--I--M--E--D--S--A--I--K--C--E--Y--M--L--N--A--I--P--K-
GGGAGGCACCCCATGCCGCAAGAGCTACGAGGACTGTGCCAGCGGCATCATGGAGGACTCGGCCATCAAGTGCGAGTACATGCTCAACGCCATCCCCAAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------------------------------------------><--
-R--L--C--L--V--C--G--D--I--A--S--G--Y--H--Y--G--V--A--S--C--E--A--C--K--A--F--F--K--R--T--I--Q--G--
CGCCTGTGCCTCGTGTGCGGGGACATTGCCTCTGGCTACCACTACGGCGTGGCCTCCTGCGAGGCTTGCAAGGCCTTCTTCAAGAGGACTATCCAAGGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
N--I--E--Y--S--C--P--A--T--N--E--C--E--I--T--K--R--R--R--K--S--C--Q--A--C--R--F--M--K--C--L--K--V--G
ACATTGAGTACAGCTGCCCGGCCACCAACGAGTGCGAGATCACCAAACGGAGGCGCAAGTCCTGCCAGGCCTGCCGCTTCATGAAATGCCTCAAAGTGGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------><-------------------------------------------------------------------------------------
--M--L--K--E--G--V--R--L--D--R--V--R--G--G--R--Q--K--Y--K--R--R--L--D--S--E--S--S--P--Y--L--S--L--Q-
GATGCTGAAGGAAGGTGTGCGCCTTGATCGAGTGCGTGGAGGCCGTCAGAAATACAAGCGACGGCTGGACTCAGAGAGCAGCCCATACCTGAGCTTACAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------><--------------------------------------------------------------------------
-I--S--P--P--A--K--K--P--L--T--K--I--V--S--Y--L--L--V--A--E--P--D--K--L--Y--A--M--P--P--P--G--M--P--
ATTTCTCCACCTGCTAAAAAGCCATTGACCAAGATTGTCTCATACCTACTGGTGGCTGAGCCGGACAAGCTCTATGCCATGCCTCCCCCTGGTATGCCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------------------><------------
E--G--D--I--K--A--L--T--T--L--C--D--L--A--D--R--E--L--V--V--I--I--G--W--A--K--H--I--P--G--F--S--S--L
AGGGGGACATCAAGGCCCTGACCACTCTCTGTGACCTGGCAGACCGAGAGCTTGTGGTCATCATTGGCTGGGCCAAGCACATCCCAGGCTTCTCAAGCCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--S--L--G--D--Q--M--S--L--L--Q--S--A--W--M--E--I--L--I--L--G--I--V--Y--R--S--L--P--Y--D--D--K--L--V-
CTCCCTGGGGGACCAGATGAGCCTGCTGCAGAGTGCCTGGATGGAAATCCTCATCCTGGGCATCGTGTACCGCTCGCTGCCCTATGACGACAAGCTGGTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-Y--A--E--D--Y--I--M--D--E--E--H--S--R--L--A--G--L--L--E--L--Y--R--A--I--L--Q--L--V--R--R--Y--K--K--
TACGCTGAGGACTACATCATGGATGAGGAGCACTCCCGCCTCGCGGGGCTGCTGGAGCTCTACCGGGCCATCCTGCAGCTGGTACGCAGGTACAAGAAGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------><------------------------------------------
L--K--V--E--K--E--E--F--V--T--L--K--A--L--A--L--A--N--S--D--S--M--Y--I--E--D--L--E--A--V--Q--K--L--Q
TCAAGGTGGAGAAGGAGGAGTTTGTGACGCTCAAGGCCCTGGCCCTCGCCAACTCCGATTCCATGTACATCGAGGATCTAGAGGCTGTCCAGAAGCTGCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--D--L--L--H--E--A--L--Q--D--Y--E--L--S--Q--R--H--E--E--P--W--R--T--G--K--L--L--L--T--L--P--L--L--R-
GGACCTGCTGCACGAGGCACTGCAGGACTACGAGCTGAGCCAGCGCCATGAGGAGCCCTGGAGGACGGGCAAGCTGCTGCTGACACTGCCGCTGCTGCGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------------------------------------------------------><---
-Q--T--A--A--K--A--V--Q--H--F--Y--S--V--K--L--Q--G--K--V--P--M--H--K--L--F--L--E--M--L--E--A--K--A--
CAGACGGCCGCCAAGGCCGTGCAGCACTTCTATAGCGTCAAACTGCAGGGCAAAGTGCCCATGCACAAACTCTTCCTGGAGATGCTGGAGGCCAAGGCCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
W--A--R--A--D--S--L--Q--E--W--R--P--L--E--Q--V--P--S--P--L--H--R--A--T--K--R--Q--H--V--H--F--L--T--P
GGGCCAGGGCTGACTCCCTTCAGGAGTGGAGGCCACTGGAGCAAGTGCCCTCTCCCCTCCACCGAGCCACCAAGAGGCAGCATGTGCATTTCCTAACTCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------><----------------
--L--P--P--P--P--S--V--A--W--V--G--T--A--Q--A--G--Y--H--L--E--V--F--L--P--Q--R--A--G--W--P--R--A--A-
CTTGCCCCCTCCCCCATCTGTGGCCTGGGTGGGCACTGCTCAGGCTGGATACCACCTGGAGGTTTTCCTTCCGCAGAGGGCAGGTTGGCCAAGAGCAGCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-->
-*-
TAG
   
---
---