Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000065325 (click for geneview)
Transcript ID ENST00000262441(link to ensembl)
Symbol GLP2R
Localtion Chromosome:17:9670106:9733747:1 band: 17p13.1
Description Glucagon-like peptide 2 receptor precursor (GLP-2 receptor) (GLP-2-R) (GLP-2R). [Source:Uniprot/SWISSPROT;Acc:O95838]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--K--L--G--S--S--R--A--G--P--G--R--G--S--A--G--L--L--P--G--V--H--E--L--P--M--G--I--P--A--P--W--G--
ATGAAGCTGGGATCGAGCAGGGCAGGGCCTGGGAGAGGAAGCGCGGGACTCCTGCCTGGCGTCCACGAGCTGCCCATGGGCATCCCTGCCCCCTGGGGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------><----------
T--S--P--L--S--F--H--R--K--C--S--L--W--A--P--G--R--P--F--L--T--L--V--L--L--V--S--I--K--Q--V--T--G--S
CCAGTCCTCTCTCCTTCCACAGGAAGTGCTCTCTCTGGGCCCCTGGGAGGCCCTTCCTCACTCTGGTCCTGCTGGTTTCCATCAAGCAAGTTACAGGATC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------><----------------------
--L--L--E--E--T--T--R--K--W--A--Q--Y--K--Q--A--C--L--R--D--L--L--K--E--P--S--G--I--F--C--N--G--T--F-
CCTCCTTGAGGAAACGACTCGGAAGTGGGCTCAGTACAAACAGGCATGTCTGAGAGACTTACTCAAGGAACCTTCTGGCATATTTTGTAACGGGACATTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------------------------------------><-----------------
-D--Q--Y--V--C--W--P--H--S--S--P--G--N--V--S--V--P--C--P--S--Y--L--P--W--W--S--E--E--S--S--G--R--A--
GATCAGTACGTGTGTTGGCCTCATTCTTCTCCTGGAAATGTCTCTGTACCCTGCCCTTCATACTTACCTTGGTGGAGTGAAGAGAGCTCAGGAAGGGCCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
Y--R--H--C--L--A--Q--G--T--W--Q--T--I--E--N--A--T--D--I--W--Q--D--D--S--E--C--S--E--N--H--S--F--K--Q
ACAGACACTGCTTGGCTCAGGGGACTTGGCAGACGATAGAGAACGCCACGGATATTTGGCAGGATGACTCCGAATGCTCCGAGAACCACAGCTTCAAGCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---><-----------------------------------------------------------------------------------------------
--N--V--D--R--Y--A--L--L--S--T--L--Q--L--M--Y--T--V--G--Y--S--F--S--L--I--S--L--F--L--A--L--T--L--L-
AAACGTGGATCGTTATGCCTTGCTGTCAACCTTGCAGCTGATGTACACCGTGGGATACTCCTTCTCTCTTATCTCCCTCTTCCTGGCTCTCACCCTCCTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------><----------------------------------------------------------------------------------------
-L--F--L--R--K--L--H--C--T--R--N--Y--I--H--M--N--L--F--A--S--F--I--L--R--T--L--A--V--L--V--K--D--V--
TTGTTTCTTCGAAAACTCCACTGCACGCGCAACTACATCCACATGAACTTGTTTGCTTCTTTCATCCTGAGAACCCTGGCTGTACTGGTGAAGGACGTCG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------><----------------------------------
V--F--Y--N--S--Y--S--K--R--P--D--N--E--N--G--W--M--S--Y--L--S--E--M--S--T--S--C--R--S--V--Q--V--L--L
TCTTCTACAACTCTTACTCCAAGAGGCCTGACAATGAGAATGGGTGGATGTCCTACCTGTCAGAGATGTCCACCTCCTGCCGCTCAGTCCAGGTTCTCTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--H--Y--F--V--G--A--N--Y--L--W--L--L--V--E--G--L--Y--L--H--T--L--L--E--P--T--V--L--P--E--R--R--L--W-
GCATTACTTTGTGGGTGCCAATTACTTATGGCTGCTGGTTGAAGGCCTCTACCTCCACACGCTGCTGGAGCCCACAGTGCTTCCTGAGAGGCGGCTGTGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------><-----------------------------------------------------------><-------------
-P--R--Y--L--L--L--G--W--A--F--P--V--L--F--V--V--P--W--G--F--A--R--A--H--L--E--N--T--G--C--W--T--T--
CCCAGATACCTGCTGTTGGGTTGGGCCTTCCCTGTGCTATTTGTTGTACCCTGGGGTTTCGCCCGTGCACACCTGGAGAACACAGGGTGCTGGACAACAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------><-------------------------------------------
N--G--N--K--K--I--W--W--I--I--R--G--P--M--M--L--C--V--T--V--N--F--F--I--F--L--K--I--L--K--L--L--I--S
ATGGGAATAAGAAAATCTGGTGGATCATCCGAGGACCCATGATGCTCTGTGTAACAGTCAATTTCTTCATCTTCCTGAAAATTCTCAAGCTTCTCATTTC
                                                        :::::.::.:::::::::::::::::::::::::::::::::::
--------------------------------------------------------GTCAACTTTTTCATCTTCCTGAAAATTCTCAAGCTTCTCATTTC
---------------------------------------------------------V--N--F--F--I--F--L--K--I--L--K--L--L--I--S

--------------------------------------------><------------------------------------------------------
--K--L--K--A--H--Q--M--C--F--R--D--Y--K--Y--R--L--A--K--S--T--L--V--L--I--P--L--L--G--V--H--E--I--L-
TAAGCTCAAAGCTCATCAAATGTGCTTCAGAGATTATAAATACAGATTGGCAAAATCAACACTGGTCCTCATTCCTTTATTGGGCGTTCATGAGATCCTC
 :::::::::::::::::.::::::::::::::::::::::::   .:::::::.:: ::.:::.:::::::.::::::.::::.:::::.:::::: ::
AAAGCTCAAAGCTCATCAGATGTGCTTCAGAGATTATAAATAC---CTGGCAAAGTCCACGCTGATCCTCATCCCTTTACTGGGTGTTCACGAGATCGTC
--K--L--K--A--H--Q--M--C--F--R--D--Y--K--Y-----L--A--K--S--T--L--I--L--I--P--L--L--G--V--H--E--I--V-

-----------------------------------------------------------------------------------><---------------
-F--S--F--I--T--D--D--Q--V--E--G--F--A--K--L--I--R--L--F--I--Q--L--T--L--S--S--F--H--G--F--L--V--A--
TTCTCTTTCATCACTGATGATCAAGTTGAAGGATTTGCAAAACTTATACGACTTTTCATTCAGTTGACACTGAGCTCCTTTCATGGGTTCCTGGTGGCCT
::: :::::.:::: ::.::::::::::::::::::::.::::::.:::::::.:::::::::::::: :::::::::::.:::                
TTCGCTTTCGTCACGGACGATCAAGTTGAAGGATTTGCGAAACTTGTACGACTCTTCATTCAGTTGACTCTGAGCTCCTTCCAT----------------
-F--A--F--V--T--D--D--Q--V--E--G--F--A--K--L--V--R--L--F--I--Q--L--T--L--S--S--F--H-----------------

-------------------------><-------------------------------------------------------------------------
L--Q--Y--G--F--A--N--G--E--V--K--A--E--L--R--K--Y--W--V--R--F--L--L--A--R--H--S--G--C--R--A--C--V--L
TGCAGTATGGTTTTGCCAATGGAGAGGTGAAGGCTGAGCTGCGGAAATACTGGGTCCGCTTCTTGCTAGCCCGCCACTCAGGCTGCAGAGCCTGTGTCCT
                          ::::::::.:::::::::::..: ::::.:::::::::::::::::.:.::::.::::::              
--------------------------GTGAAGGCCGAGCTGCGGAAGCAGTGGGCCCGCTTCTTGCTAGCCCACTACTCGGGCTGC--------------
---------------------------V--K--A--E--L--R--K--Q--W--A--R--F--L--L--A--H--Y--S--G--C---------------

----------------------------------------------------------------------------------------------------
--G--K--D--F--R--F--L--G--K--C--P--K--K--L--S--E--G--D--G--A--E--K--L--R--K--L--Q--P--S--L--N--S--G-
GGGGAAGGACTTCCGGTTCCTAGGAAAATGTCCCAAGAAGCTCTCGGAAGGAGATGGCGCTGAGAAGCTTCGGAAGCTGCAGCCCTCACTTAACAGTGGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-R--L--L--H--L--A--M--R--G--L--G--E--L--G--A--Q--P--Q--Q--D--H--A--R--W--P--R--G--S--S--L--S--E--C--
CGGCTCCTACATCTAGCCATGCGAGGTCTTGGGGAGCTGGGCGCCCAGCCCCAACAGGACCATGCACGCTGGCCCCGGGGCAGCAGCCTGTCCGAGTGCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------->
S--E--G--D--V--T--M--A--N--T--M--E--E--I--L--E--E--S--E--I--*-
GTGAGGGGGATGTCACCATGGCCAACACCATGGAGGAGATTCTGGAAGAGAGTGAGATCTAG
                                                              
--------------------------------------------------------------
--------------------------------------------------------------

Pig Consensus Sequence

>BGISUST0000877980
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
--------------------------------------------------------GTCAACTTTTTCATCTTCCTGAAAATTCTCAAGCTTCTCATTTC
AAAGCTCAAAGCTCATCAGATGTGCTTCAGAGATTATAAATAC---CTGGCAAAGTCCACGCTGATCCTCATCCCTTTACTGGGTGTTCACGAGATCGTC
TTCGCTTTCGTCACGGACGATCAAGTTGAAGGATTTGCGAAACTTGTACGACTCTTCATTCAGTTGACTCTGAGCTCCTTCCAT----------------
--------------------------GTGAAGGCCGAGCTGCGGAAGCAGTGGGCCCGCTTCTTGCTAGCCCACTACTCGGGCTGC--------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
--------------------------------------------------------------


>BGISUSP0000877980
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------VNFFIFLKILKLLISKLKAHQMCFRDYKY-LAKSTLILIPLLGVHEIV
FAFVTDDQVEGFAKLVRLFIQLTLSSFH--------------VKAELRKQWARFLLAHYSGC--------------------------------------
------------------------------------------------------