Sequences
EST Library Info
eru1Foetus 50 days, regio umbilicalis
pigcb1Unavailable
plac2Unavailable
ute3Uterus
Clusters
Oligos
SNPs

Gene ID ENSG00000076706 (click for geneview)
Transcript ID ENST00000264036(link to ensembl)
Symbol MCAM
Localtion Chromosome:11:118684196:118693050:-1 band: 11q23.3
Description Cell surface glycoprotein MUC18 precursor (Melanoma-associated antigen MUC18) (Melanoma-associated antigen A32) (S-endo 1 endothelial- associated antigen) (CD146 antigen) (Melanoma adhesion molecule). [Source:Uniprot/SWISSPROT;Acc:P43121]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-----------------------------------------------------------------><--------------------------------
-M--G--L--P--R--L--V--C--A--F--L--L--A--A--C--C--C--C--P--R--V--A--G--V--P--G--E--A--E--Q--P--A--P--
ATGGGGCTTCCCAGGCTGGTCTGCGCCTTCTTGCTCGCCGCCTGCTGCTGCTGTCCTCGCGTCGCGGGTGTGCCCGGAGAGGCTGAGCAGCCTGCGCCTG
                                                                     :::::.:::::::: ::: ::::.:::::::
---------------------------------------------------------------------GTGCCTGGAGAGGCGGAGAAGCCCGCGCCTG
----------------------------------------------------------------------V--P--G--E--A--E--K--P--A--P--

-------------------------------------------------------------------------------------------><-------
E--L--V--E--V--E--V--G--S--T--A--L--L--K--C--G--L--S--Q--S--Q--G--N--L--S--H--V--D--W--F--S--V--H--K
AGCTGGTGGAGGTGGAAGTGGGCAGCACAGCCCTTCTGAAGTGCGGCCTCTCCCAGTCCCAAGGCAACCTCAGCCATGTCGACTGGTTTTCTGTCCACAA
::::: :::::::::::::::: .::::::::::::::::::::::::.:::::: :::::..:::::.:::::::.:: ::::::::::::::::::::
AGCTGCTGGAGGTGGAAGTGGGAGGCACAGCCCTTCTGAAGTGCGGCCCCTCCCATTCCCAGAGCAACTTCAGCCACGTGGACTGGTTTTCTGTCCACAA
E--L--L--E--V--E--V--G--G--T--A--L--L--K--C--G--P--S--H--S--Q--S--N--F--S--H--V--D--W--F--S--V--H--K

----------------------------------------------------------------------------------------------------
--E--K--R--T--L--I--F--R--V--R--Q--G--Q--G--Q--S--E--P--G--E--Y--E--Q--R--L--S--L--Q--D--R--G--A--T-
GGAGAAGCGGACGCTCATCTTCCGTGTGCGCCAGGGCCAGGGCCAGAGCGAACCTGGGGAGTACGAGCAGCGGCTCAGCCTCCAGGACAGAGGGGCTACT
:::::::: .::.::::::::::: ::::: :::::::::::::::::.::.:::::::::::: :::: :::::: .:::::::::::..:::.: :::
GGAGAAGCCAACACTCATCTTCCGGGTGCGGCAGGGCCAGGGCCAGAGTGAGCCTGGGGAGTACCAGCATCGGCTCCACCTCCAGGACAAGGGGACGACT
--E--K--P--T--L--I--F--R--V--R--Q--G--Q--G--Q--S--E--P--G--E--Y--Q--H--R--L--H--L--Q--D--K--G--T--T-

--------------------------------------------------------------------------------------------------->
-L--A--L--T--Q--V--T--P--Q--D--E--R--I--F--L--C--Q--G--K--R--P--R--S--Q--E--Y--R--I--Q--L--R--V--Y--
CTGGCCCTGACTCAAGTCACCCCCCAAGACGAGCGCATCTTCTTGTGCCAGGGCAAGCGCCCTCGGTCCCAGGAGTACCGCATCCAGCTCCGCGTCTACA
:::::::::::::: .:::::::::: :::::::::::::::.:::::::::::::::::::.::::::::::::.:::::.:::::::::: :::::: 
CTGGCCCTGACTCACATCACCCCCCATGACGAGCGCATCTTCCTGTGCCAGGGCAAGCGCCCCCGGTCCCAGGAGCACCGCGTCCAGCTCCGGGTCTAC-
-L--A--L--T--H--I--T--P--H--D--E--R--I--F--L--C--Q--G--K--R--P--R--S--Q--E--H--R--V--Q--L--R--V--Y--

<---------------------------------------------------------------------><----------------------------
K--A--P--E--E--P--N--I--Q--V--N--P--L--G--I--P--V--N--S--K--E--P--E--E--V--A--T--C--V--G--R--N--G--Y
AAGCTCCGGAGGAGCCAAACATCCAGGTCAACCCCCTGGGCATCCCTGTGAACAGTAAGGAGCCTGAGGAGGTCGCTACCTGTGTAGGGAGGAACGGGTA
                                                                       ::.:::::::::::.::::::::::::::
-----------------------------------------------------------------------GTTGCTACCTGTGTGGGGAGGAACGGGTA
------------------------------------------------------------------------V--A--T--C--V--G--R--N--G--Y

----------------------------------------------------------><----------------------------------------
--P--I--P--Q--V--I--W--Y--K--N--G--R--P--L--K--E--E--K--N--R--V--H--I--Q--S--S--Q--T--V--E--S--S--G-
CCCCATTCCTCAAGTCATCTGGTACAAGAATGGCCGGCCTCTGAAGGAGGAGAAGAACCGGGTCCACATTCAGTCGTCCCAGACTGTGGAGTCGAGTGGT
:::: : :::::::::::::::::.::::::::::::::.::.:::::::::::::::                                          
CCCCCTGCCTCAAGTCATCTGGTATAAGAATGGCCGGCCCCTAAAGGAGGAGAAGAAC------------------------------------------
--P--L--P--Q--V--I--W--Y--K--N--G--R--P--L--K--E--E--K--N-------------------------------------------

----------------------------------------------------------------------------------------------------
-L--Y--T--L--Q--S--I--L--K--A--Q--L--V--K--E--D--K--D--A--Q--F--Y--C--E--L--N--Y--R--L--P--S--G--N--
TTGTACACCTTGCAGAGTATTCTGAAGGCACAGCTGGTTAAAGAAGACAAAGATGCCCAGTTTTACTGTGAGCTCAACTACCGGCTGCCCAGTGGGAACC
                                             :::::::::::::::::::::::::::::::.:::::::::::::::::::::::
---------------------------------------------GACAAAGATGCCCAGTTTTACTGTGAGCTCAGCTACCGGCTGCCCAGTGGGAACC
----------------------------------------------D--K--D--A--Q--F--Y--C--E--L--S--Y--R--L--P--S--G--N--

--------------------------------------><------------------------------------------------------------
H--M--K--E--S--R--E--V--T--V--P--V--F--Y--P--T--E--K--V--W--L--E--V--E--P--V--G--M--L--K--E--G--D--R
ACATGAAGGAGTCCAGGGAAGTCACCGTCCCTGTTTTCTACCCGACAGAAAAAGTGTGGCTGGAAGTGGAGCCCGTGGGAATGCTGAAGGAAGGGGACCG
:::::::::::::.  :::.::::. :::::.::::::   :::.:.::.:.:::::::.:::::::::::::.: :::::::::::::::.::::::::
ACATGAAGGAGTCTCCGGAGGTCATGGTCCCCGTTTTC---CCGGCGGAGAGAGTGTGGTTGGAAGTGGAGCCTGAGGGAATGCTGAAGGAGGGGGACCG
H--M--K--E--S--P--E--V--M--V--P--V--F-----P--A--E--R--V--W--L--E--V--E--P--E--G--M--L--K--E--G--D--R

------------------------------------------------------------><--------------------------------------
--V--E--I--R--C--L--A--D--G--N--P--P--P--H--F--S--I--S--K--Q--N--P--S--T--R--E--A--E--E--E--T--T--N-
CGTGGAAATCAGGTGTTTGGCTGATGGCAACCCTCCACCACACTTCAGCATCAGCAAGCAGAACCCCAGCACCAGGGAGGCAGAGGAAGAGACAACCAAC
::::::::::::::::.:::::::::::::.::.::::: :::::::::::::::::::::                                       
CGTGGAAATCAGGTGTCTGGCTGATGGCAATCCCCCACCCCACTTCAGCATCAGCAAGCAG---------------------------------------
--V--E--I--R--C--L--A--D--G--N--P--P--P--H--F--S--I--S--K--Q----------------------------------------

----------------------------------------------------------------------------------------------------
-D--N--G--V--L--V--L--E--P--A--R--K--E--H--S--G--R--Y--E--C--Q--G--L--D--L--D--T--M--I--S--L--L--S--
GACAACGGGGTCCTGGTGCTGGAGCCTGCCCGGAAGGAACACAGTGGGCGCTATGAATGTCAGGGCCTGGACTTGGACACCATGATATCGCTGCTGAGTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------><---------------------------------------------------------------------------
E--P--Q--E--L--L--V--N--Y--V--S--D--V--R--V--S--P--A--A--P--E--R--Q--E--G--S--S--L--T--L--T--C--E--A
AACCACAGGAACTACTGGTGAACTATGTGTCTGACGTCCGAGTGAGTCCCGCAGCCCCTGAGAGACAGGAAGGCAGCAGCCTCACCCTGACCTGTGAGGC
                          :::::.::.:::::.:::::.:::::::::::.::::: :::::.:::::::::::::::::::::::::::::
--------------------------GTGTCCGATGTCCGGGTGAGCCCCGCAGCCCCCGAGAGCCAGGAGGGCAGCAGCCTCACCCTGACCTGTGAGGC
---------------------------V--S--D--V--R--V--S--P--A--A--P--E--S--Q--E--G--S--S--L--T--L--T--C--E--A

------------------------------------------><--------------------------------------------------------
--E--S--S--Q--D--L--E--F--Q--W--L--R--E--E--T--G--Q--V--L--E--R--G--P--V--L--Q--L--H--D--L--K--R--E-
AGAGAGTAGCCAGGACCTCGAGTTCCAGTGGCTGAGAGAAGAGACAGGCCAGGTGCTGGAAAGGGGGCCTGTGCTTCAGTTGCATGACCTGAAACGGGAG
::::::::.:::::::::.:::::::::::::::::::::.:::::::: :::::::::::::::::::::::::.::.::.:.:.:::::::.::::::
AGAGAGTAACCAGGACCTTGAGTTCCAGTGGCTGAGAGAAAAGACAGGCAAGGTGCTGGAAAGGGGGCCTGTGCTCCAATTACGTAACCTGAAGCGGGAG
--E--S--N--Q--D--L--E--F--Q--W--L--R--E--K--T--G--K--V--L--E--R--G--P--V--L--Q--L--R--N--L--K--R--E-

------------------------------------------------------------------------------------><--------------
-A--G--G--G--Y--R--C--V--A--S--V--P--S--I--P--G--L--N--R--T--Q--L--V--N--V--A--I--F--G--P--P--W--M--
GCAGGAGGCGGCTATCGCTGCGTGGCGTCTGTGCCCAGCATACCCGGCCTGAACCGCACACAGCTGGTCAACGTGGCCATTTTTGGCCCCCCTTGGATGG
: :::::: :::::.:::::::::::.::::..:::::..::::.:::::::::::.:: ::::::::::::::::::::::::                
GAAGGAGGAGGCTACCGCTGCGTGGCATCTGCACCCAGTGTACCTGGCCTGAACCGTACCCAGCTGGTCAACGTGGCCATTTTT----------------
-E--G--G--G--Y--R--C--V--A--S--A--P--S--V--P--G--L--N--R--T--Q--L--V--N--V--A--I--F-----------------

----------------------------------------------------------------------------------------------------
A--F--K--E--R--K--V--W--V--K--E--N--M--V--L--N--L--S--C--E--A--S--G--H--P--R--P--T--I--S--W--N--V--N
CATTCAAGGAGAGGAAGGTGTGGGTGAAAGAGAATATGGTGTTGAATCTGTCTTGTGAAGCGTCAGGGCACCCCCGGCCCACCATCTCCTGGAACGTCAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------><--------------------------------------------------------------------------------------------
--G--T--A--S--E--Q--D--Q--D--P--Q--R--V--L--S--T--L--N--V--L--V--T--P--E--L--L--E--T--G--V--E--C--T-
CGGCACGGCAAGTGAACAAGACCAAGATCCACAGCGAGTCCTGAGCACCCTGAATGTCCTCGTGACCCCGGAGCTGTTGGAGACAGGTGTTGAATGCACG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------><--------------------------------------------------
-A--S--N--D--L--G--K--N--T--S--I--L--F--L--E--L--V--N--L--T--T--L--T--P--D--S--N--T--T--T--G--L--S--
GCCTCCAACGACCTGGGCAAAAACACCAGCATCCTCTTCCTGGAGCTGGTCAATTTAACCACCCTCACACCAGACTCCAACACAACCACTGGCCTCAGCA
                                                                                    :::: :.:::::::::
------------------------------------------------------------------------------------ACCAATAGCCTCAGCA
-------------------------------------------------------------------------------------T--N--S--L--S--

--------------------------------------------><------------------------------------------------------
T--S--T--A--S--P--H--T--R--A--N--S--T--S--T--E--R--K--L--P--E--P--E--S--R--G--V--V--I--V--A--V--I--V
CTTCCACTGCCAGTCCTCATACCAGAGCCAACAGCACCTCCACAGAGAGAAAGCTGCCGGAGCCGGAGAGCCGGGGCGTGGTCATCGTGGCTGTGATTGT
:.:::::. .:::.:::: :.:::::::::::::::::::::::   ::::::::::::::::: :::::: .::::::::::::::::::.::::..::
CCTCCACCTTCAGCCCTCCTGCCAGAGCCAACAGCACCTCCACA---AGAAAGCTGCCGGAGCCTGAGAGCAAGGGCGTGGTCATCGTGGCCGTGACCGT
T--S--T--F--S--P--P--A--R--A--N--S--T--S--T-----R--K--L--P--E--P--E--S--K--G--V--V--I--V--A--V--T--V

--------------------------------------------------------------------------------------------><------
--C--I--L--V--L--A--V--L--G--A--V--L--Y--F--L--Y--K--K--G--K--L--P--C--R--R--S--G--K--Q--E--I--T--L-
GTGCATCCTGGTCCTGGCGGTGCTGGGCGCTGTCCTCTATTTCCTCTATAAGAAGGGCAAGCTGCCGTGCAGGCGCTCAGGGAAGCAGGAGATCACGCTA
:::..::::::::::::: ::::::::.:::::.:::::::::.::::.::::::::::::::::::::..:.:: ::::: ::.::.:::   :::::.
GTGTGTCCTGGTCCTGGCCGTGCTGGGTGCTGTTCTCTATTTCTTCTACAAGAAGGGCAAGCTGCCGTGTGGACGGTCAGGCAAACAAGAG---ACGCTG
--C--V--L--V--L--A--V--L--G--A--V--L--Y--F--F--Y--K--K--G--K--L--P--C--G--R--S--G--K--Q--E-----T--L-

----------------------------------------------------------------------------------------------------
-P--P--S--R--K--S--E--L--V--V--E--V--K--S--D--K--L--P--E--E--M--G--L--L--Q--G--S--S--G--D--K--R--A--
CCCCCGTCTCGTAAGAGCGAACTTGTAGTTGAAGTTAAGTCAGATAAGCTCCCAGAAGAGATGGGCCTCCTGCAGGGCAGCAGCGGTGACAAGAGGGCTC
:::::::::::::::::::::.::::::::::::::::::::::::::::::::::::::::::::::::: ::::::::::.:::::::::::::::::
CCCCCGTCTCGTAAGAGCGAATTTGTAGTTGAAGTTAAGTCAGATAAGCTCCCAGAAGAGATGGGCCTCCTTCAGGGCAGCAACGGTGACAAGAGGGCTC
-P--P--S--R--K--S--E--F--V--V--E--V--K--S--D--K--L--P--E--E--M--G--L--L--Q--G--S--N--G--D--K--R--A--

----------><---------------------------->
P--G--D--Q--G--E--K--Y--I--D--L--R--H--*-
CGGGAGACCAGGGAGAGAAATACATCGATCTGAGGCATTAG
:.:::::::::                              
CAGGAGACCAG------------------------------
P--G--D--Q-------------------------------

Pig Consensus Sequence

>BGISUST0000883455
---------------------------------------------------------------------GTGCCTGGAGAGGCGGAGAAGCCCGCGCCTG
AGCTGCTGGAGGTGGAAGTGGGAGGCACAGCCCTTCTGAAGTGCGGCCCCTCCCATTCCCAGAGCAACTTCAGCCACGTGGACTGGTTTTCTGTCCACAA
GGAGAAGCCAACACTCATCTTCCGGGTGCGGCAGGGCCAGGGCCAGAGTGAGCCTGGGGAGTACCAGCATCGGCTCCACCTCCAGGACAAGGGGACGACT
CTGGCCCTGACTCACATCACCCCCCATGACGAGCGCATCTTCCTGTGCCAGGGCAAGCGCCCCCGGTCCCAGGAGCACCGCGTCCAGCTCCGGGTCTAC-
-----------------------------------------------------------------------GTTGCTACCTGTGTGGGGAGGAACGGGTA
CCCCCTGCCTCAAGTCATCTGGTATAAGAATGGCCGGCCCCTAAAGGAGGAGAAGAAC------------------------------------------
---------------------------------------------GACAAAGATGCCCAGTTTTACTGTGAGCTCAGCTACCGGCTGCCCAGTGGGAACC
ACATGAAGGAGTCTCCGGAGGTCATGGTCCCCGTTTTC---CCGGCGGAGAGAGTGTGGTTGGAAGTGGAGCCTGAGGGAATGCTGAAGGAGGGGGACCG
CGTGGAAATCAGGTGTCTGGCTGATGGCAATCCCCCACCCCACTTCAGCATCAGCAAGCAG---------------------------------------
----------------------------------------------------------------------------------------------------
--------------------------GTGTCCGATGTCCGGGTGAGCCCCGCAGCCCCCGAGAGCCAGGAGGGCAGCAGCCTCACCCTGACCTGTGAGGC
AGAGAGTAACCAGGACCTTGAGTTCCAGTGGCTGAGAGAAAAGACAGGCAAGGTGCTGGAAAGGGGGCCTGTGCTCCAATTACGTAACCTGAAGCGGGAG
GAAGGAGGAGGCTACCGCTGCGTGGCATCTGCACCCAGTGTACCTGGCCTGAACCGTACCCAGCTGGTCAACGTGGCCATTTTT----------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
------------------------------------------------------------------------------------ACCAATAGCCTCAGCA
CCTCCACCTTCAGCCCTCCTGCCAGAGCCAACAGCACCTCCACA---AGAAAGCTGCCGGAGCCTGAGAGCAAGGGCGTGGTCATCGTGGCCGTGACCGT
GTGTGTCCTGGTCCTGGCCGTGCTGGGTGCTGTTCTCTATTTCTTCTACAAGAAGGGCAAGCTGCCGTGTGGACGGTCAGGCAAACAAGAG---ACGCTG
CCCCCGTCTCGTAAGAGCGAATTTGTAGTTGAAGTTAAGTCAGATAAGCTCCCAGAAGAGATGGGCCTCCTTCAGGGCAGCAACGGTGACAAGAGGGCTC
CAGGAGACCAG------------------------------


>BGISUSP0000883455
-----------------------VPGEAEKPAPELLEVEVGGTALLKCGPSHSQSNFSHVDWFSVHKEKPTLIFRVRQGQGQSEPGEYQHRLHLQDKGTT
LALTHITPHDERIFLCQGKRPRSQEHRVQLRVY------------------------VATCVGRNGYPLPQVIWYKNGRPLKEEKN--------------
---------------DKDAQFYCELSYRLPSGNHMKESPEVMVPVF-PAERVWLEVEPEGMLKEGDRVEIRCLADGNPPPHFSISKQ-------------
------------------------------------------VSDVRVSPAAPESQEGSSLTLTCEAESNQDLEFQWLREKTGKVLERGPVLQLRNLKRE
EGGGYRCVASAPSVPGLNRTQLVNVAIF------------------------------------------------------------------------
----------------------------TNSLSTSTFSPPARANSTST-RKLPEPESKGVVIVAVTVCVLVLAVLGAVLYFFYKKGKLPCGRSGKQE-TL
PPSRKSEFVVEVKSDKLPEEMGLLQGSNGDKRAPGDQ----------