Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000002822 (click for geneview)
Transcript ID ENST00000265854(link to ensembl)
Symbol MAD1L1
Localtion Chromosome:7:1628673:2043019:-1 band: 7p22.3
Description Mitotic spindle assembly checkpoint protein MAD1 (Mitotic arrest deficient-like protein 1) (MAD1-like 1) (Mitotic checkpoint MAD1 protein-homolog) (HsMAD1) (hMAD1) (Tax binding protein-181).
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--E--D--L--G--E--N--T--M--V--L--S--T--L--R--S--L--N--N--F--I--S--Q--R--V--E--G--G--S--G--L--D--I--
ATGGAAGACCTGGGGGAAAACACCATGGTTTTATCCACCCTGAGATCTTTGAACAACTTCATCTCTCAGCGTGTGGAGGGAGGCTCTGGACTGGATATTT
:::::::::::::: ::::::::::. ::..: :::::::::::.::.:::::::.::::::::::::::: ::::::::::: :::::::::::..: :
ATGGAAGACCTGGGCGAAAACACCACCGTCCTCTCCACCCTGAGGTCCTTGAACAGCTTCATCTCTCAGCGAGTGGAGGGAGGGTCTGGACTGGACGTGT
-M--E--D--L--G--E--N--T--T--V--L--S--T--L--R--S--L--N--S--F--I--S--Q--R--V--E--G--G--S--G--L--D--V--

-------------------------------------------------><-------------------------------------------------
S--T--S--A--P--G--S--L--Q--M--Q--Y--Q--Q--S--M--Q--L--E--E--R--A--E--Q--I--R--S--K--S--H--L--I--Q--V
CTACCTCGGCCCCAGGTTCTCTGCAGATGCAGTACCAGCAGAGCATGCAGCTGGAGGAAAGAGCAGAGCAGATCCGTTCGAAGTCCCACCTCATCCAGGT
:.:::.: :: : :::::::::::::::::::::::::::::::::::::::::::::. ::::::::::::::::::::::::::::::::::::::::
CCACCCCTGCGCAAGGTTCTCTGCAGATGCAGTACCAGCAGAGCATGCAGCTGGAGGAGCGAGCAGAGCAGATCCGTTCGAAGTCCCACCTCATCCAGGT
S--T--P--A--Q--G--S--L--Q--M--Q--Y--Q--Q--S--M--Q--L--E--E--R--A--E--Q--I--R--S--K--S--H--L--I--Q--V

------------------------------------------------------------------------------------------><--------
--E--R--E--K--M--Q--M--E--L--S--H--K--R--A--R--V--E--L--E--R--A--A--S--T--S--A--R--N--Y--E--R--E--V-
GGAGCGGGAGAAAATGCAGATGGAGCTGAGTCACAAGAGGGCTCGAGTGGAGCTGGAGAGAGCAGCCAGCACCAGTGCCAGGAACTACGAGCGTGAGGTC
::::::::::::.::::::::::::::::::::::::::::::::::::::::::::: :.::.:::::.:::::.:::::::.:::::::::.::::: 
GGAGCGGGAGAAGATGCAGATGGAGCTGAGTCACAAGAGGGCTCGAGTGGAGCTGGAGCGGGCGGCCAGTACCAGCGCCAGGAGCTACGAGCGCGAGGTG
--E--R--E--K--M--Q--M--E--L--S--H--K--R--A--R--V--E--L--E--R--A--A--S--T--S--A--R--S--Y--E--R--E--V-

----------------------------------------------------------------------------------------------------
-D--R--N--Q--E--L--L--T--R--I--R--Q--L--Q--E--R--E--A--G--A--E--E--K--M--Q--E--Q--L--E--R--N--R--Q--
GACCGCAACCAGGAGCTCCTGACGCGCATCCGGCAGCTTCAGGAGCGGGAGGCCGGGGCGGAGGAGAAGATGCAGGAGCAGCTGGAGCGCAACAGGCAGT
:::::::::::::::::::::::::::::.:::::::: :::::::::::::::                                              
GACCGCAACCAGGAGCTCCTGACGCGCATTCGGCAGCTGCAGGAGCGGGAGGCC----------------------------------------------
-D--R--N--Q--E--L--L--T--R--I--R--Q--L--Q--E--R--E--A-----------------------------------------------

----------------------------------------------------------------------><----------------------------
C--Q--Q--N--L--D--A--A--S--K--R--L--R--E--K--E--D--S--L--A--Q--A--G--E--T--I--N--A--L--K--G--R--I--S
GTCAGCAGAACTTGGATGCTGCCAGCAAGAGGCTGCGTGAGAAAGAGGACAGTCTGGCCCAGGCTGGCGAGACCATCAACGCACTGAAGGGGAGGATCTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------------------------------------------------------><---
--E--L--Q--W--S--V--M--D--Q--E--M--R--V--K--R--L--E--S--E--K--Q--E--L--Q--E--Q--L--D--L--Q--H--K--K-
GGAACTGCAGTGGAGCGTGATGGACCAGGAGATGCGGGTGAAGCGCCTGGAGTCGGAGAAGCAGGAGCTGCAGGAGCAGCTGGACCTGCAACACAAAAAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------------------------------------><---------------------
-C--Q--E--A--N--Q--K--I--Q--E--L--Q--A--S--Q--E--A--R--A--D--H--E--Q--Q--I--K--D--L--E--Q--K--L--S--
TGCCAGGAAGCCAATCAGAAAATCCAGGAACTCCAGGCCAGCCAAGAAGCAAGAGCAGACCACGAGCAGCAGATTAAGGATCTGGAGCAGAAGCTGTCCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
L--Q--E--Q--D--A--A--I--V--K--N--M--K--S--E--L--V--R--L--P--R--L--E--R--E--L--K--Q--L--R--E--E--S--A
TGCAAGAGCAGGATGCAGCGATTGTGAAGAACATGAAGTCTGAGCTGGTACGGCTCCCTAGGCTGGAACGGGAGCTGAAGCAGCTGCGGGAGGAGAGCGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------><------------------------------------------------------------------------------------------
--H--L--R--E--M--R--E--T--N--G--L--L--Q--E--E--L--E--G--L--Q--R--K--L--G--R--Q--E--K--M--Q--E--T--L-
GCACCTGCGGGAGATGAGAGAGACCAACGGGCTGCTCCAGGAAGAGCTGGAAGGGCTGCAGAGGAAGCTGGGGCGCCAGGAGAAGATGCAGGAGACGCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------><------------------------------------------------------------><-------------
-V--G--L--E--L--E--N--E--R--L--L--A--K--L--Q--S--W--E--R--L--D--Q--T--M--G--L--S--I--R--T--P--E--D--
GTTGGCTTGGAGCTGGAGAACGAGAGGCTGCTGGCCAAGCTGCAAAGCTGGGAGAGACTGGACCAGACCATGGGCCTGAGCATCAGGACTCCAGAAGACC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------------------><--------------------------
L--S--R--F--V--V--E--L--Q--Q--R--E--L--A--L--K--D--K--N--S--A--V--T--S--S--A--R--G--L--E--K--A--R--Q
TTTCCAGATTCGTGGTTGAGCTGCAGCAGAGGGAGCTTGCCTTGAAGGACAAGAACAGCGCCGTCACCAGCAGCGCCCGGGGGCTGGAGAAGGCCAGGCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--Q--L--Q--E--E--L--R--Q--V--S--G--Q--L--L--E--E--R--K--K--R--E--T--H--E--A--L--A--R--R--L--Q--K--R-
GCAGCTGCAGGAGGAGCTCCGGCAGGTCAGCGGCCAGCTGTTGGAGGAGAGGAAGAAGCGCGAGACCCACGAGGCGCTGGCCCGGAGGCTCCAGAAACGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------><---------------------------------------------------------------------------------
-V--L--L--L--T--K--E--R--D--G--M--R--A--I--L--G--S--Y--D--S--E--L--T--P--A--E--Y--S--P--Q--L--T--R--
GTCCTGCTGCTCACCAAGGAGCGGGACGGTATGCGGGCCATCCTGGGGTCCTACGACAGCGAGCTGACCCCGGCCGAGTACTCACCCCAGCTGACGCGGC
                  :::::::::::.::::: ::::::::::::::::::::::::::::::::::::::::::::: :.::::::::::: ::::
------------------GAGCGGGACGGCATGCGTGCCATCCTGGGGTCCTACGACAGCGAGCTGACCCCGGCCGAGTACGCGCCCCAGCTGACCCGGC
-------------------E--R--D--G--M--R--A--I--L--G--S--Y--D--S--E--L--T--P--A--E--Y--A--P--Q--L--T--R--

----------------------------------------------------------><----------------------------------------
R--M--R--E--A--E--D--M--V--Q--K--V--H--S--H--S--A--E--M--E--A--Q--L--S--Q--A--L--E--E--L--G--G--Q--K
GCATGCGGGAGGCTGAGGATATGGTGCAGAAGGTGCACAGCCACAGCGCCGAGATGGAGGCTCAGCTGTCGCAGGCCCTGGAGGAGCTGGGAGGCCAGAA
:: :::: :::::.:::::.:::::::::::::: :::.  :::::: : :::.:::::                                         
GCCTGCGCGAGGCCGAGGACATGGTGCAGAAGGTCCACGCGCACAGCTCGGAGGTGGAG-----------------------------------------
R--L--R--E--A--E--D--M--V--Q--K--V--H--A--H--S--S--E--V--E------------------------------------------

---------------><-----------------------------------------------------------------------------------
--Q--R--A--D--M--L--E--M--E--L--K--M--L--K--S--Q--S--S--S--A--E--Q--S--F--L--F--S--R--E--E--A--D--T-
ACAAAGAGCAGACATGCTGGAGATGGAGCTGAAGATGCTGAAGTCTCAGTCCAGCTCTGCCGAACAGAGCTTCCTGTTCTCCAGGGAGGAGGCGGACACG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----><-----------------------------------------------------------------------------------------><---
-L--R--L--K--V--E--E--L--E--G--E--R--S--R--L--E--E--E--K--R--M--L--E--A--Q--L--E--R--R--A--L--Q--G--
CTCAGGTTGAAGGTCGAGGAGCTGGAAGGCGAGCGGAGTCGGCTGGAGGAGGAAAAGAGGATGCTGGAGGCACAGCTGGAGCGGCGAGCTCTGCAGGGTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
D--Y--D--Q--S--R--T--K--V--L--H--M--S--L--N--P--T--S--V--A--R--Q--R--L--R--E--D--H--S--Q--L--Q--A--E
ACTATGACCAGAGCAGGACCAAAGTGCTGCACATGAGCCTGAACCCCACCAGTGTGGCCAGGCAGCGCCTGCGCGAGGACCACAGCCAGCTGCAGGCGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--C--E--R--L--R--G--L--L--R--A--M--E--R--G--G--T--V--P--A--D--L--E--A--A--A--A--S--L--P--S--S--K--E-
GTGCGAGCGACTGCGCGGGCTCCTGCGCGCCATGGAGAGAGGAGGCACCGTCCCAGCCGACCTTGAGGCTGCCGCCGCGAGTCTGCCATCGTCCAAGGAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------><--------------------------------------------------------------------------------------------
-V--A--E--L--K--K--Q--V--E--S--A--E--L--K--N--Q--R--L--K--E--V--F--Q--T--K--I--Q--E--F--R--K--A--C--
GTGGCAGAGCTGAAGAAGCAGGTGGAGAGTGCCGAGCTGAAGAACCAGCGGCTCAAGGAGGTTTTCCAGACCAAGATCCAGGAGTTCCGCAAGGCCTGCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------------------------------><------><-----
Y--T--L--T--G--Y--Q--I--D--I--T--T--E--N--Q--Y--R--L--T--S--L--Y--A--E--H--P--G--D--C--S--S--R--P--P
ACACGCTCACCGGCTACCAGATCGACATCACCACGGAGAACCAGTACCGGCTGACCTCGCTGTACGCCGAGCACCCAGGCGACTGCTCTTCAAGGCCACC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--A--P--R--V--P--R--C--S--Y--W--R--Q--S--S--H--T--P--W--A--S--S--S--R--C--T--C--G--A--R--T--A--S--L-
AGCCCCTCGGGTTCCAAGATGCAGCTACTGGAGACAGAGTTCTCACACACCGTGGGCGAGCTCATCGAGGTGCACCTGCGGCGCCAGGACAGCATCCCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-P--S--S--A--R--S--P--S--S--S--S--A--A--R--P--W--R--S--L--Q--A--R--G--H--S--R--S--H--S--A--W--P--D--
CCTTCCTCAGCTCGCTCACCCTCGAGCTCTTCAGCCGCCAGACCGTGGCGTAGCCTGCAGGCTCGGGGGCATAGCCGGAGCCACTCTGCTTGGCCTGACC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
L--Q--V--P--C--P--A--S--H--R--L--G--A--R--P--A--S--P--A--P--Q--G--S--S--M--T--D--R--H--A--G--T--Y--V
TGCAGGTCCCCTGCCCCGCCAGCCACAGGCTGGGTGCACGTCCTGCCTCTCCAGCCCCACAGGGCAGCAGCATGACTGACAGACACGCTGGGACCTACGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--G--L--P--A--G--A--A--S--T--L--S--T--C--R--P--H--A--S--R--S--L--V--C--G--R--R--P--P--A--W--V--P--H-
CGGGCTTCCTGCTGGGGCGGCCAGCACCCTCTCCACGTGCAGACCCCATGCGTCCCGGAGCCTGGTGTGTGGGCGTCGGCCACCAGCCTGGGTTCCTCAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------->
-L--V--K--*-
CTTGTGAAATAA
            
------------
------------

Pig Consensus Sequence

>BGISUST0000897810
ATGGAAGACCTGGGCGAAAACACCACCGTCCTCTCCACCCTGAGGTCCTTGAACAGCTTCATCTCTCAGCGAGTGGAGGGAGGGTCTGGACTGGACGTGT
CCACCCCTGCGCAAGGTTCTCTGCAGATGCAGTACCAGCAGAGCATGCAGCTGGAGGAGCGAGCAGAGCAGATCCGTTCGAAGTCCCACCTCATCCAGGT
GGAGCGGGAGAAGATGCAGATGGAGCTGAGTCACAAGAGGGCTCGAGTGGAGCTGGAGCGGGCGGCCAGTACCAGCGCCAGGAGCTACGAGCGCGAGGTG
GACCGCAACCAGGAGCTCCTGACGCGCATTCGGCAGCTGCAGGAGCGGGAGGCC----------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
------------------GAGCGGGACGGCATGCGTGCCATCCTGGGGTCCTACGACAGCGAGCTGACCCCGGCCGAGTACGCGCCCCAGCTGACCCGGC
GCCTGCGCGAGGCCGAGGACATGGTGCAGAAGGTCCACGCGCACAGCTCGGAGGTGGAG-----------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
------------


>BGISUSP0000897810
MEDLGENTTVLSTLRSLNSFISQRVEGGSGLDVSTPAQGSLQMQYQQSMQLEERAEQIRSKSHLIQVEREKMQMELSHKRARVELERAASTSARSYEREV
DRNQELLTRIRQLQEREA----------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
------ERDGMRAILGSYDSELTPAEYAPQLTRRLREAEDMVQKVHAHSSEVE-----------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----