Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000178773 (click for geneview)
Transcript ID ENST00000268720(link to ensembl)
Symbol CPNE7
Localtion Chromosome:16:88169677:88191155:1 band: 16q24.3
Description Copine-7 (Copine VII). [Source:Uniprot/SWISSPROT;Acc:Q9UBL6]
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--S--A--G--S--E--R--G--A--A--A--T--P--G--G--L--P--A--P--C--A--S--K--V--E--L--R--L--S--C--R--H--L--
ATGAGCGCGGGCTCGGAGCGCGGGGCGGCGGCAACCCCCGGGGGTTTGCCCGCGCCCTGCGCCTCGAAGGTGGAGCTGCGGCTCAGCTGCCGGCACCTGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------------------><-------------------------
L--D--R--D--P--L--T--K--S--D--P--S--V--A--L--L--Q--Q--A--Q--G--Q--W--V--Q--V--G--R--T--E--V--V--R--S
TGGACCGCGACCCGCTCACCAAGTCCGACCCCAGCGTGGCGTTGCTGCAGCAGGCGCAGGGCCAGTGGGTGCAGGTGGGCAGAACCGAGGTGGTCCGGAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--S--L--H--P--V--F--S--K--V--F--T--V--D--Y--Y--F--E--E--V--Q--R--L--R--F--E--V--Y--D--T--H--G--P--S-
CAGCCTGCATCCCGTGTTCTCCAAGGTCTTCACGGTGGACTACTACTTCGAGGAGGTGCAGAGGCTGCGCTTTGAGGTGTACGACACGCATGGGCCCAGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------><------------------------------------------
-G--F--S--C--Q--E--D--D--F--L--G--G--M--E--C--T--L--G--Q--P--A--Q--K--W--L--L--Q--V--V--M--R--V--S--
GGCTTCAGCTGTCAGGAGGACGATTTCCTGGGGGGCATGGAGTGCACCCTGGGGCAGCCAGCCCAAAAGTGGCTTCTGCAAGTCGTGATGAGAGTGTCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------------------------------------------><--
V--D--V--L--G--P--A--G--H--C--A--K--H--F--L--C--C--T--E--S--S--H--L--A--R--T--G--P--S--F--L--L--R--Y
TTGATGTGCTGGGCCCTGCTGGACACTGCGCTAAGCACTTCCTGTGCTGCACGGAATCCTCACACCTTGCCAGGACGGGTCCTTCTTTTTTATTGAGGTA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------------------------------------><-----------------
--D--D--L--C--L--P--W--A--T--A--G--A--V--R--W--W--T--C--R--G--G--H--T--Q--G--W--Q--I--V--A--Q--K--K-
TGATGACCTCTGCCTCCCCTGGGCGACTGCTGGCGCCGTGAGGTGGTGGACGTGCAGGGGTGGCCACACGCAGGGATGGCAGATTGTGGCCCAGAAGAAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------><------------------------------------------
-V--T--R--P--L--L--L--K--F--G--R--N--A--G--K--S--T--I--T--V--I--A--E--D--I--S--G--N--N--G--Y--V--E--
GTGACCCGCCCGCTGCTGCTCAAGTTTGGCAGGAACGCTGGCAAGTCCACCATCACGGTGATCGCCGAGGACATCTCGGGGAACAACGGCTACGTGGAGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------><-------------------------------------------------------------------
L--S--F--R--A--R--K--L--D--D--K--D--L--F--S--K--S--D--P--F--L--E--L--Y--R--V--N--D--D--Q--G--L--Q--L
TCTCCTTCCGGGCCAGGAAGCTGGACGACAAGGACCTCTTCAGCAAGTCCGACCCCTTCCTGGAGCTCTACAGGGTCAACGACGACCAGGGCTTGCAGCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------><-----------------------------------------------------------------------------------
--V--Y--R--T--E--V--V--K--N--N--L--N--P--V--W--E--A--F--K--V--S--L--S--S--L--C--S--C--E--E--T--R--P-
GGTGTACAGGACGGAGGTGGTGAAGAACAACCTGAACCCGGTGTGGGAGGCCTTCAAAGTCTCTCTGAGTTCCCTCTGCAGCTGCGAGGAGACAAGGCCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----><---------------------------------------------------------------------------------------------
-L--K--C--L--V--W--D--Y--D--S--R--G--K--H--D--F--I--G--E--F--S--T--T--F--E--E--M--Q--K--A--F--E--E--
CTAAAGTGCCTGGTCTGGGATTACGACTCTCGAGGAAAGCACGACTTCATCGGAGAATTCTCTACCACCTTCGAGGAGATGCAGAAGGCCTTTGAGGAGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----><-------------------------------------------------------------------------------------><-------
G--Q--A--Q--W--D--C--V--N--P--K--Y--K--Q--K--R--R--S--Y--K--N--S--G--V--V--V--L--A--D--L--K--F--H--R
GGCAGGCCCAGTGGGACTGTGTGAACCCCAAATACAAGCAGAAGAGACGCAGTTATAAGAACTCAGGAGTGGTCGTCCTGGCTGACCTCAAGTTCCACAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------><-----------------------------------------------
--V--Y--S--F--L--D--Y--I--M--G--G--C--Q--I--H--F--T--V--A--I--D--F--T--A--S--N--G--D--P--R--N--S--C-
GGTGTACTCCTTCCTGGACTATATCATGGGCGGCTGCCAGATCCACTTCACCGTGGCCATTGACTTCACCGCCTCCAATGGAGACCCGCGGAACAGCTGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------------------------------><-------------
-S--L--H--Y--I--N--P--Y--Q--P--N--E--Y--L--K--A--L--V--S--V--G--E--I--C--Q--D--Y--D--S--D--K--R--F--
TCCCTGCACTACATCAACCCCTACCAGCCGAACGAGTACCTGAAGGCACTGGTGTCCGTGGGCGAGATCTGCCAGGACTATGACAGTGACAAGAGGTTTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------><--------------------------------------------------><------
S--A--L--G--F--G--A--R--I--P--P--K--Y--E--V--S--H--D--F--A--I--N--F--N--P--E--D--D--E--C--E--G--I--Q
CCGCTTTGGGGTTTGGAGCCCGGATCCCTCCCAAGTATGAGGTGTCCCATGACTTTGCCATCAATTTCAACCCTGAGGACGATGAGTGTGAAGGCATCCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--G--V--V--E--A--Y--Q--N--C--L--P--R--V--Q--L--Y--G--P--T--N--V--A--P--I--I--S--K--V--A--R--V--A--A-
GGGCGTGGTGGAGGCCTACCAGAACTGCCTGCCCAGGGTCCAGCTCTACGGCCCCACCAACGTGGCGCCCATCATCTCCAAGGTGGCACGCGTGGCGGCG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------><------------------------------------------------------------------------
-A--E--E--S--T--G--K--A--S--Q--Y--Y--I--L--L--I--L--T--D--G--V--V--T--D--M--A--D--T--R--E--A--I--V--
GCCGAGGAGAGCACCGGGAAAGCCTCTCAATACTACATCCTGCTGATCCTGACGGACGGCGTGGTGACCGACATGGCCGACACACGGGAGGCCATTGTGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
R--A--S--R--L--P--M--S--I--I--I--V--G--V--G--N--A--D--F--T--D--M--Q--V--L--D--G--D--D--G--V--L--R--S
GTGCCTCACGCCTGCCCATGTCCATCATCATCGTGGGCGTGGGCAACGCCGACTTCACCGACATGCAGGTCCTGGACGGCGACGACGGCGTCCTGCGCTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------------------><-----------------------------------
--P--R--G--E--P--A--L--R--D--I--V--Q--F--V--P--F--R--E--L--K--N--A--S--P--A--A--L--A--K--C--V--L--A-
CCCACGGGGTGAGCCCGCGCTCCGGGACATCGTACAGTTCGTGCCCTTCCGGGAGCTCAAGAACGCATCCCCTGCGGCGCTGGCCAAGTGCGTGCTGGCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-E--V--P--K--Q--V--V--E--Y--Y--S--H--R--G--L--P--P--R--S--L--G--V--P--A--G--E--A--S--P--G--C--T--P--
GAGGTCCCGAAGCAGGTGGTGGAGTACTACAGCCACAGAGGCCTGCCCCCGAGAAGCCTGGGTGTCCCTGCCGGAGAGGCCAGCCCAGGCTGCACACCGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

->
*-
GA
  
--
--