Sequences
EST Library Info
amn2Amnion
cbr8Brain - RNA from China
cga2Galactophore - RNA from China
cly1Lymph - RNA from China
csp1Spleen - RNA from China
cst1Stomach - RNA from China
ebs3Foetus 50 days, brain stem
ese1Foetus 50 days, M. semitendinosus
fbs1Unavailable
fhi2Unavailable
lnt1Lymphatic nodule tracheobroncalis
med1Mediastinum
nco1Newborn 115 days, colon
nje1Newborn 115 days, jejunum
nlu2Newborn 115 days, lung
nmm1Newborn 115 days, mucosal membranes
plac3Unavailable
relu3Unavailable
ste2M. Semitendinosus
ton1Tip of tongue, mucosal membrane
Clusters
Oligos
SNPs

Gene ID ENSG00000141498 (click for geneview)
Transcript ID ENST00000269290(link to ensembl)
Symbol Q9P0C7_HUMAN
Localtion Chromosome:17:6856652:6858479:-1 band: 17p13.1
Description HSPC254 (Fragment).
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--P--E--M--G--E--G--I--Q--S--L--A--R--E--T--Q--S--R--R--G--R--R--Q--G--W--D--A--T--W--V--T--R--C--
ATGCCAGAGATGGGAGAAGGGATTCAGTCTCTCGCCCGGGAAACCCAGTCCCGCAGAGGGCGCCGGCAAGGGTGGGACGCGACCTGGGTGACACGGTGCA
                ::::::::: .::::: ::: ::::::::::::::   ...:: . : :.  .::  : :.:: :.:  :::.:. .. :  :.
---------------CAAGGGATTCCATCTCTAGCCAGGGAAACCCAGTCCGCAGAGGGCTCCAGAATGGGCGG-GGCGGGGCAGGGGCGGGGTTGACCG
----------------Q--G--I--P--S--L--A--R--E--T--Q--S--A--E--G--S--R--M--G--W--G--G--A--G--A--G--L--T--

----------------------------------------------------------------------------------------------------
R--E--S--L--N--R-----G--G--A--G--A--G--K--R--A--G--A--L--A--H--H--V--F--L--A--L--I--E--P--N--L--A--E
GGGAGTCTTTAAATAGA---GGAGGGGCTGGAGCGGGGAAACGCGCCGGGGCCCTAGCGCACCATGTATTCCTTGCGCTTATTGAGCCGAACTTGGCAGA
:: .:::::::::::::   :..:::::::::::::::::::::. .:: ::.::::::::::::.::::::::::::::::::::::::::::::::::
GGTGGTCTTTAAATAGAA--GAGGGGGCTGGAGCGGGGAAACGCAGTGGTGCTCTAGCGCACCATATATTCCTTGCGCTTATTGAGCCGAACTTGGCAGA
G--W--S--L--N--R--\--K--G--A--G--A--G--K--R--S--G--A--L--A--H--H--I--F--L--A--L--I--E--P--N--L--A--E

------------------------------------------------------------------------------------------------><--
--R--E--A--S--E--E--E--V--K--A--C--S--D--E--T--V--V--A--D--L--L--V--K--V--V--Y--V--L--G--A--I--G--V-
AAGAGAAGCCTCCGAGGAGGAGGTAAAGGCCTGCAGCGATGAAACAGTTGTAGCTGACTTGCTCGTAAAGGTTGTATATGTTCTGGGGGCCATTGGGGTG
:::::::::::::::::::.:::::::::::.::.::::::::::::::::::::::::::::::::.:: ::::::::::.::::::::::::      
AAGAGAAGCCTCCGAGGAGAAGGTAAAGGCCCGCGGCGATGAAACAGTTGTAGCTGACTTGCTCGTAGAGCTTGTATATGTCCTGGGGGCCATT------
--R--E--A--S--E--E--K--V--K--A--R--G--D--E--T--V--V--A--D--L--L--V--E--L--V--Y--V--L--G--A--I-------

------------------><-----------------------------------------------------------------------><><-----
-G--M--K--Q--R--G--N--V--L--N--Q--H--S--G--M--D--I--E--K--Y--S--E--H--Y--L--E--K--G--N--G--G--A--E--
GGAATGAAGCAAAGGGGGAACGTCCTCAATCAACACAGCGGAATGGACATTGAAAAATATTCCGAGCATTATCTGGAAAAGGGGAATGGGGGCGCTGAGG
                  ::::::.::::: :.::::::.::.:::::::::::::: ::::::::::::::                     :::.:::
------------------AACGTCTTCAATGAGCACAGCAGAGTGGACATTGAAAAAGATTCCGAGCATTAT---------------------GCTAAGG
-------------------N--V--F--N--E--H--S--R--V--D--I--E--K--D--S--E--H--Y-----------------------A--K--

----------------------------------------------------------------------------------------------------
D--D--A--A--G--G--Q--L--R--P--T--A--Q--E--R--R--H--K--E--G--S--R--G--S--P--R-----C--K--R--A--R--K--A
ACGATGCCGCAGGCGGCCAGCTTCGGCCCACAGCACAGGAGCGACGCCATAAAGAAGGGAGTCGGGGATCGCCGAGG---TGCAAGCGGGCTCGGAAAGC
::::::::::::::::::::::: ::::::::::::::.:::::::::::.:::::::::::::::::::::: ::.      .. :.:::: :.::.::
ACGATGCCGCAGGCGGCCAGCTTGGGCCCACAGCACAGAAGCGACGCCATGAAGAAGGGAGTCGGGGATCGCCTAGAG--GTGGGCCAGGCTAGAAAGGC
D--D--A--A--G--G--Q--L--G--P--T--A--Q--K--R--R--H--E--E--G--S--R--G--S--P--R--\--V--G--Q--A--R--K--A

----------------------------
--V--G--E--S--P--G--C--P--R-
GGTGGGAGAAAGCCCAGGATGCCCTCGC
::..::::. :: ::.. . :::::   
GGCAGGAGG-AGGCCGATGAGCCCT---
--A--G--E--R--P--M--S--P----

Pig Consensus Sequence

>BGISUST0000895011
---------------CAAGGGATTCCATCTCTAGCCAGGGAAACCCAGTCCGCAGAGGGCTCCAGAATGGGcgGCGGGGCAGGGGCGGGGTTGACCGGGT
GGTCTTTAAATAGagAGGGGGCTGGAGCGGGGAAACGCAGTGGTGCTCTAGCGCACCATATATTCCTTGCGCTTATTGAGCCGAACTTGGCAGAAAGAGA
AGCCTCCGAGGAGAAGGTAAAGGCCCGCGGCGATGAAACAGTTGTAGCTGACTTGCTCGTAGAGCTTGTATATGTCCTGGGGGCCATT------------
------------AACGTCTTCAATGAGCACAGCAGAGTGGACATTGAAAAAGATTCCGAGCATTAT---------------------GCTAAGGACGATG
CCGCAGGCGGCCAGCTTGGGCCCACAGCACAGAAGCGACGCCATGAAGAAGGGAGTCGGGGATCGCCTAGagTGGGCCAGGCTAGAAAGGCGGCAGGaaG
GCCGATGAGCCCT---


>BGISUSP0000895011
-----QGIPSLARETQSAEGSRMGGGAGAGLTGWSLNREGAGAGKRSGALAHHIFLALIEPNLAEREASEEKVKARGDETVVADLLVELVYVLGAI----
----NVFNEHSRVDIEKDSEHY-------AKDDAAGGQLGPTAQKRRHEEGSRGSPRVGQARKAAGRPMSP-