Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000143167 (click for geneview)
Transcript ID ENST00000271383(link to ensembl)
Symbol GPA33
Localtion Chromosome:1:163753740:163791526:-1 band: 1q24.1
Description Cell surface A33 antigen precursor (Glycoprotein A33). [Source:Uniprot/SWISSPROT;Acc:Q99795]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-----------------------------------------><--------------------------------------------------------
-M--V--G--K--M--W--P--V--L--W--T--L--C--A--V--R--V--T--V--D--A--I--S--V--E--T--P--Q--D--V--L--R--A--
ATGGTGGGGAAGATGTGGCCTGTGTTGTGGACACTCTGTGCAGTCAGGGTGACCGTCGATGCCATCTCTGTGGAAACTCCGCAGGACGTTCTTCGGGCTT
                                              :::::::.::: :::::::::::::::::::.::. ::::.:::::::::::: 
---------------------------------------------TGGGTGACTGTCCATGCCATCTCTGTGGAAACCCCAAAGGATGTTCTTCGGGCTG
----------------------------------------------W--V--T--V--H--A--I--S--V--E--T--P--K--D--V--L--R--A--

-------------------------------------------------------------------------------------------------><-
S--Q--G--K--S--V--T--L--P--C--T--Y--H--T--S--T--S--S--R--E--G--L--I--Q--W--D--K--L--L--L--T--H--T--E
CGCAGGGAAAGAGTGTCACCCTGCCCTGCACCTACCACACTTCCACCTCCAGTCGAGAGGGACTTATTCAATGGGATAAGCTCCTCCTCACTCATACGGA
: :.::::.::::::::::::: :: ::.:::::::: :::::: ::..::..:::::.:::.::::.::.:::::.:::::.::    : :::::::  
CTCGGGGAGAGAGTGTCACCCTTCCGTGTACCTACCAAACTTCCTCCCTCAACCGAGAAGGATTTATCCAGTGGGACAAGCTTCTAAGGAGTCATACG--
A--R--G--E--S--V--T--L--P--C--T--Y--Q--T--S--S--L--N--R--E--G--F--I--Q--W--D--K--L--L--R--S--H--T---

----------------------------------------------------------------------------------------------------
--R--V--V--I--W--P--F--S--N--K--N--Y--I--H--G--E--L--Y--K--N--R--V--S--I--S--N--N--A--E--Q--S--D--A-
AAGGGTGGTCATCTGGCCGTTTTCAAACAAAAACTACATCCATGGTGAGCTTTATAAGAATCGCGTCAGCATATCCAACAATGCTGAGCAGTCCGATGCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-S--I--T--I--D--Q--L--T--M--A--D--N--G--T--Y--E--C--S--V--S--L--M--S--D--L--E--G--N--T--K--S--R--V--
TCCATCACCATTGATCAGCTGACCATGGCTGACAACGGCACCTACGAGTGTTCTGTCTCGCTGATGTCAGACCTGGAGGGCAACACCAAGTCACGTGTCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------><------------------------------------------------------------------------------------
R--L--L--V--L--V--P--P--S--K--P--E--C--G--I--E--G--E--T--I--I--G--N--N--I--Q--L--T--C--Q--S--K--E--G
GCCTGTTGGTCCTCGTGCCACCCTCCAAACCAGAATGCGGCATCGAGGGAGAGACCATAATTGGGAACAACATCCAGCTGACCTGCCAATCAAAGGAGGG
                 ::::::::::: ::::: ::::::::: ::::::::::..:::::::::::.::::::::::::::::: :::: ::::::::
-----------------CCACCCTCCAACCCAGACTGCGGCATCCAGGGAGAGACTGTAATTGGGAACGACATCCAGCTGACCTGCGAATCCAAGGAGGG
------------------P--P--S--N--P--D--C--G--I--Q--G--E--T--V--I--G--N--D--I--Q--L--T--C--E--S--K--E--G

----------------------------------------------------------------------><----------------------------
--S--P--T--P--Q--Y--S--W--K--R--Y--N--I--L--N--Q--E--Q--P--L--A--Q--P--A--S--G--Q--P--V--S--L--K--N-
CTCACCAACCCCTCAGTACAGCTGGAAGAGGTACAACATCCTGAATCAGGAGCAGCCCCTGGCCCAGCCAGCCTCAGGTCAGCCTGTCTCCCTGAAGAAT
::: :::.:::::::::::::::::::::: ::..::.: :::::.:::::::. : .: ::.:  .:::                              
CTCCCCAGCCCCTCAGTACAGCTGGAAGAGCTATGACGTGCTGAACCAGGAGCGTCATCAGGTCACACCA------------------------------
--S--P--A--P--Q--Y--S--W--K--S--Y--D--V--L--N--Q--E--R--H--Q--V--T--P-------------------------------

------------------------------------------------------------------------------------------><--------
-I--S--T--D--T--S--G--Y--Y--I--C--T--S--S--N--E--E--G--T--Q--F--C--N--I--T--V--A--V--R--S--P--S--M--
ATCTCCACAGACACATCGGGTTACTACATCTGTACCTCCAGCAATGAGGAGGGGACGCAGTTCTGCAACATCACGGTGGCCGTCAGATCTCCCTCCATGA
                                                                                             :::::::
---------------------------------------------------------------------------------------------TCCATGA
----------------------------------------------------------------------------------------------S--M--

----------------------------------------------------------------------------------------------------
N--V--A--L--Y--V--G--I--A--V--G--V--V--A--A--L--I--I--I--G--I--I--I--Y--C--C--C--C--R--G--K--D--D--N
ACGTGGCCCTGTATGTGGGCATCGCGGTGGGCGTGGTTGCAGCCCTCATTATCATTGGCATCATCATCTACTGCTGCTGCTGCCGAGGGAAGGACGACAA
:::::::::::::.:.::::::::::: ::::::::. ::.::::::::.:::::.:::.:::::.::::::::::::::                    
ACGTGGCCCTGTACGCGGGCATCGCGGGGGGCGTGGCGGCGGCCCTCATCATCATCGGCGTCATCGTCTACTGCTGCTGC--------------------
N--V--A--L--Y--A--G--I--A--G--G--V--A--A--A--L--I--I--I--G--V--I--V--Y--C--C--C---------------------

--------------------------><------------------------------------------------------------------------
--T--E--D--K--E--D--A--R--P--N--R--E--A--Y--E--E--P--P--E--Q--L--R--E--L--S--R--E--R--E--E--E--D--D-
CACTGAAGACAAGGAGGATGCAAGGCCGAACCGGGAAGCCTATGAGGAGCCACCAGAGCAGCTAAGAGAACTTTCCAGAGAGAGGGAGGAGGAGGATGAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------->
-Y--R--Q--E--E--Q--R--S--T--G--R--E--S--P--D--H--L--D--Q--*-
TACAGGCAAGAAGAGCAGAGGAGCACTGGGCGTGAATCCCCGGACCACCTCGACCAGTGA
                                                            
------------------------------------------------------------
------------------------------------------------------------

Pig Consensus Sequence

>BGISUST0000893812
---------------------------------------------TGGGTGACTGTCCATGCCATCTCTGTGGAAACCCCAAAGGATGTTCTTCGGGCTG
CTCGGGGAGAGAGTGTCACCCTTCCGTGTACCTACCAAACTTCCTCCCTCAACCGAGAAGGATTTATCCAGTGGGACAAGCTTCTAAGGAGTCATACG--
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
-----------------CCACCCTCCAACCCAGACTGCGGCATCCAGGGAGAGACTGTAATTGGGAACGACATCCAGCTGACCTGCGAATCCAAGGAGGG
CTCCCCAGCCCCTCAGTACAGCTGGAAGAGCTATGACGTGCTGAACCAGGAGCGTCATCAGGTCACACCA------------------------------
---------------------------------------------------------------------------------------------TCCATGA
ACGTGGCCCTGTACGCGGGCATCGCGGGGGGCGTGGCGGCGGCCCTCATCATCATCGGCGTCATCGTCTACTGCTGCTGC--------------------
----------------------------------------------------------------------------------------------------
------------------------------------------------------------


>BGISUSP0000893812
---------------WVTVHAISVETPKDVLRAARGESVTLPCTYQTSSLNREGFIQWDKLLRSHT----------------------------------
---------------------------------------PPSNPDCGIQGETVIGNDIQLTCESKEGSPAPQYSWKSYDVLNQERHQVTP----------
-------------------------------SMNVALYAGIAGGVAAALIIIGVIVYCCC----------------------------------------
--------------------