Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000143947 (click for geneview)
Transcript ID ENST00000272317(link to ensembl)
Symbol RPS27A
Localtion Chromosome:2:55371475:55374396:1 band: 2p16.1
Description 40S ribosomal protein S27a.
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<----------------------------------------------><---------------------------------------------------
-M--Q--I--F--V--K--T--L--T--G--K--T--I--T--L--E--V--E--P--S--D--T--I--E--N--V--K--A--K--I--Q--D--K--
ATGCAGATTTTCGTGAAAACCCTTACGGGGAAGACCATCACCCTCGAGGTTGAACCCTCGGATACGATAGAAAATGTAAAGGCCAAGATCCAGGATAAGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--><------------------------------------------------------------------------------------><----------
E--G--I--P--P--D--Q--Q--R--L--I--F--A--G--K--Q--L--E--D--G--R--T--L--S--D--Y--N--I--Q--K--E--S--T--L
AAGGAATTCCTCCTGATCAGCAGAGACTGATCTTTGCTGGCAAGCAGCTGGAAGATGGACGTACTTTGTCTGACTACAATATTCAAAAGGAGTCTACTCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--H--L--V--L--R--L--R--G--G--A--K--K--R--K--K--K--S--Y--T--T--P--K--K--N--K--H--K--R--K--K--V--K--L-
TCATCTTGTGTTGAGACTTCGTGGTGGTGCTAAGAAAAGGAAGAAGAAGTCTTACACCACTCCCAAGAAGAATAAGCACAAGAGAAAGAAGGTTAAGCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------><------------------------------------------------------------------------------
-A--V--L--K--Y--Y--K--V--D--E--N--G--K--I--S--R--L--R--R--E--C--P--S--D--E--C--G--A--G--V--F--M--A--
GCTGTCCTGAAATATTATAAGGTGGATGAGAATGGCAAAATTAGTCGCCTTCGTCGAGAGTGCCCTTCTGATGAATGTGGTGCTGGGGTGTTTATGGCAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------------------------->
S--H--F--D--R--H--Y--C--G--K--C--C--L--T--Y--C--F--N--K--P--E--D--K--*-
GTCACTTTGACAGACATTATTGTGGCAAATGTTGTCTGACTTACTGTTTCAACAAACCAGAAGACAAGTAA
                                                                       
-----------------------------------------------------------------------
-----------------------------------------------------------------------