Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000146857 (click for geneview)
Transcript ID ENST00000275764(link to ensembl)
Symbol NP_872295.1
Localtion Chromosome:7:134373986:134400499:1 band: 7q33
Description STRA8
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<----------------------------------------------------------><---------------------------------------
-M--G--K--I--D--V--D--K--I--L--F--F--N--Q--E--I--R--L--W--Q--L--I--M--A--T--P--E--E--N--S--N--P--H--
ATGGGGAAGATTGATGTGGACAAGATCCTCTTTTTCAATCAAGAAATCAGGCTGTGGCAGCTTATAATGGCAACCCCTGAAGAAAACAGCAATCCCCATG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
D--R--A--T--P--Q--L--P--A--Q--L--Q--E--L--E--H--R--V--A--R--R--R--L--S--Q--A--R--H--R--A--T--L--A--A
ACAGAGCAACACCCCAGCTGCCAGCACAGCTGCAGGAGCTTGAGCATCGGGTGGCCCGGAGACGGCTGTCCCAGGCCCGCCACCGAGCCACCCTGGCAGC
                                                                 :::::::::::::::: .:::::::::::::::: 
-----------------------------------------------------------------CTGTCCCAGGCCCGCCTTCGAGCCACCCTGGCAGG
------------------------------------------------------------------L--S--Q--A--R--L--R--A--T--L--A--G

---------------------------------------------------------><-----------------------------------------
--L--F--N--N--L--R--K--T--V--Y--S--Q--S--D--L--I--A--S--K--W--Q--V--L--N--K--A--K--S--H--I--P--E--L-
GCTCTTCAACAACCTCAGGAAGACAGTGTACTCTCAGTCTGATCTCATAGCCTCAAAGTGGCAGGTTCTGAATAAGGCAAAGAGTCATATTCCAGAACTG
::::::::.::::::::::::..: :: ::::.::: :::::.::::.::::::::::::::::::..::::::.:::.:::. :::.:::: .:::::.
GCTCTTCAGCAACCTCAGGAAAGCCGTTTACTTTCACTCTGACCTCACAGCCTCAAAGTGGCAGGTCTTGAATAGGGCGAAGGCTCACATTCAGGAACTA
--L--F--S--N--L--R--K--A--V--Y--F--H--S--D--L--T--A--S--K--W--Q--V--L--N--R--A--K--A--H--I--Q--E--L-

---------------------------------><-----------------------------------------------------------------
-E--Q--T--L--D--N--L--L--K--L--K--A--S--F--N--L--E--D--G--H--A--S--S--L--E--E--V--K--K--E--Y--A--S--
GAGCAAACCCTGGATAATTTGCTGAAGCTGAAAGCATCCTTCAACCTGGAAGATGGGCATGCAAGCAGCTTAGAGGAGGTCAAGAAAGAATATGCCAGCA
::.:::::::::::::::.::::::::::::::                                                                   
GAACAAACCCTGGATAATCTGCTGAAGCTGAAA-------------------------------------------------------------------
-E--Q--T--L--D--N--L--L--K--L--K--------------------------------------------------------------------

------------------><-------------------------><-----------------------------------------------------
M--Y--S--G--N--D--S--F--P--Q--N--G--S--S--P--W--Y--L--N--F--Y--K--Q--T--M--D--L--L--T--G--S--G--I--I
TGTATTCTGGAAATGACAGTTTTCCTCAGAATGGTTCCTCCCCTTGGTATCTCAACTTTTACAAACAGACGATGGACCTTCTGACTGGCAGCGGGATCAT
                                               ::.::::::::.:::::.:::::::::::::::::::..:: :.:::::::.:
-----------------------------------------------TACCTCAACTTCTACAAGCAGACGATGGACCTTCTGATCGGGAACGGGATCGT
------------------------------------------------Y--L--N--F--Y--K--Q--T--M--D--L--L--I--G--N--G--I--V

----------------------------------------------------------------------------------------------------
--T--P--Q--E--A--A--L--P--I--V--S--A--A--I--S--H--L--W--Q--N--L--S--E--E--R--K--A--S--L--R--Q--A--W-
TACCCCGCAGGAGGCGGCGCTGCCCATCGTCTCCGCGGCCATCTCCCACCTGTGGCAGAACCTCTCGGAGGAGAGGAAGGCCAGCCTCCGGCAGGCCTGG
. ::.:::::::::.:.:::: :::::::: ::.::.:::::::::::::::::::::: :::::: :::::::::::::::::::::. ::::::.:::
CTCCTCGCAGGAGGTGACGCTCCCCATCGTGTCTGCAGCCATCTCCCACCTGTGGCAGACCCTCTCTGAGGAGAGGAAGGCCAGCCTCTTGCAGGCTTGG
--S--S--Q--E--V--T--L--P--I--V--S--A--A--I--S--H--L--W--Q--T--L--S--E--E--R--K--A--S--L--L--Q--A--W-

----------------------------------------------------------------------------------------------------
-A--Q--K--H--R--G--P--A--T--L--A--E--A--C--R--E--P--A--C--A--E--G--S--V--K--D--S--G--V--D--S--Q--G--
GCGCAGAAGCACCGCGGCCCTGCGACCCTGGCGGAGGCCTGCCGAGAGCCGGCCTGTGCCGAGGGCAGCGTGAAGGACAGCGGCGTGGACAGCCAGGGGG
:.:::::::::: :.::::.. :.. ::: :::::::::::.: .::::::::: :::::::::::::::: ::::::::::: :: :::::::::::::
GTGCAGAAGCACAGTGGCCTCCCAGGCCTCGCGGAGGCCTGTCCGGAGCCGGCCGGTGCCGAGGGCAGCGTCAAGGACAGCGGAGTCGACAGCCAGGGGG
-V--Q--K--H--S--G--L--P--G--L--A--E--A--C--P--E--P--A--G--A--E--G--S--V--K--D--S--G--V--D--S--Q--G--

-------------------------------><-------------------------------------------------------------------
A--S--C--S--L--V--S--T--P--E--E--I--L--F--E--D--A--F--D--V--A--S--F--L--D--K--S--E--V--P--S--T--S--S
CCAGCTGCTCGCTGGTCTCCACGCCCGAGGAGATCCTTTTTGAGGATGCCTTTGATGTGGCAAGCTTCCTGGACAAAAGTGAGGTTCCGAGTACATCTAG
::::::::::.::::: ::::: :::::::::                                                                    
CCAGCTGCTCACTGGTATCCACCCCCGAGGAG--------------------------------------------------------------------
A--S--C--S--L--V--S--T--P--E--E---------------------------------------------------------------------

-----><---------------------------------------------------------------------------------------------
--S--S--S--V--L--A--S--C--N--P--E--N--P--E--E--K--F--Q--L--Y--M--Q--I--I--N--F--F--K--G--L--S--C--A-
CTCCAGTTCAGTGCTTGCCAGCTGCAACCCAGAAAACCCAGAGGAGAAGTTTCAGCTCTATATGCAGATCATCAACTTTTTTAAAGGCCTTAGCTGTGCA
       :: ::::: :::: ::::::::::::::: :: ::::::::::::::::::::.::::::::::::.:.::::::::::::::: ::::::. 
-------TCCGTGCTGGCCATCTGCAACCCAGAAAAGCCCGAGGAGAAGTTTCAGCTCTACATGCAGATCATCGATTTTTTTAAAGGCCTTTGCTGTGTT
--------S--V--L--A--I--C--N--P--E--K--P--E--E--K--F--Q--L--Y--M--Q--I--I--D--F--F--K--G--L--C--C--V-

-----------------><------------------------------------------------------------------------->
-N--T--Q--V--K--Q--E--A--S--F--P--V--D--E--E--M--I--M--L--Q--C--T--E--T--F--D--D--E--D--L--*-
AACACTCAAGTAAAGCAGGAAGCATCCTTTCCCGTTGATGAAGAGATGATCATGTTGCAGTGCACAGAGACCTTTGACGATGAAGATTTGTAA
::::: ::. : ::.:::                                                                           
AACACGCAGTTCAAACAG---------------------------------------------------------------------------
-N--T--Q--F--K--Q----------------------------------------------------------------------------

Pig Consensus Sequence

>BGISUST0000881760
----------------------------------------------------------------------------------------------------
-----------------------------------------------------------------CTGTCCCAGGCCCGCCTTCGAGCCACCCTGGCAGG
GCTCTTCAGCAACCTCAGGAAAGCCGTTTACTTTCACTCTGACCTCACAGCCTCAAAGTGGCAGGTCTTGAATAGGGCGAAGGCTCACATTCAGGAACTA
GAACAAACCCTGGATAATCTGCTGAAGCTGAAA-------------------------------------------------------------------
-----------------------------------------------TACCTCAACTTCTACAAGCAGACGATGGACCTTCTGATCGGGAACGGGATCGT
CTCCTCGCAGGAGGTGACGCTCCCCATCGTGTCTGCAGCCATCTCCCACCTGTGGCAGACCCTCTCTGAGGAGAGGAAGGCCAGCCTCTTGCAGGCTTGG
GTGCAGAAGCACAGTGGCCTCCCAGGCCTCGCGGAGGCCTGTCCGGAGCCGGCCGGTGCCGAGGGCAGCGTCAAGGACAGCGGAGTCGACAGCCAGGGGG
CCAGCTGCTCACTGGTATCCACCCCCGAGGAG--------------------------------------------------------------------
-------TCCGTGCTGGCCATCTGCAACCCAGAAAAGCCCGAGGAGAAGTTTCAGCTCTACATGCAGATCATCGATTTTTTTAAAGGCCTTTGCTGTGTT
AACACGCAGTTCAAACAG---------------------------------------------------------------------------


>BGISUSP0000881760
-------------------------------------------------------LSQARLRATLAGLFSNLRKAVYFHSDLTASKWQVLNRAKAHIQEL
EQTLDNLLKLK--------------------------------------YLNFYKQTMDLLIGNGIVSSQEVTLPIVSAAISHLWQTLSEERKASLLQAW
VQKHSGLPGLAEACPEPAGAEGSVKDSGVDSQGASCSLVSTPEE-------------------------SVLAICNPEKPEEKFQLYMQIIDFFKGLCCV
NTQFKQ-------------------------