Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000099251 (click for geneview)
Transcript ID ENST00000277668(link to ensembl)
Localtion Chromosome:10:38685294:38707438:1 band: 10p11.21
Description 17-beta-hydroxysteroid dehydrogenase type VII-like [Source:RefSeq_peptide;Acc:NP_878249]
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------><----------------------------------------------
-M--P--N--P--Q--L--N--I--K--A--L--L--F--G--L--F--S--R--K--V--I--H--M--F--S--T--A--E--G--L--L--T--Q--
ATGCCTAATCCACAACTAAATATCAAAGCACTTCTCTTTGGCCTCTTTTCAAGAAAAGTGATTCATATGTTCTCCACAGCTGAAGGCCTGCTGACCCAGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------------><-------------------------------
G--D--K--I--T--A--D--G--L--Q--E--V--F--E--T--D--V--F--G--H--F--I--L--I--R--E--L--E--P--L--L--C--H--S
GTGATAAGATCACTGCTGATGGACTTCAGGAGGTGTTTGAGACCGATGTCTTTGGCCATTTTATCCTGATTCGGGAACTGGAGCCTCTCCTCTGTCACAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--D--N--P--S--Q--L--I--W--T--S--S--R--N--A--R--K--S--N--F--S--L--E--D--F--Q--H--S--K--G--K--E--P--Y-
TGACAATCCATCTCAGCTCATCTGGACATCATCTCGCAATGCAAGGAAATCTAATTTCAGCCTCGAGGACTTCCAGCACAGCAAAGGCAAGGAACCCTAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------------------><-----------------------------------
-S--S--S--K--Y--A--T--D--L--L--S--V--A--L--N--R--N--F--Q--P--A--G--S--L--F--Q--C--G--L--S--R--Y--S--
AGCTCTTCCAAATATGCCACTGACCTTTTGAGTGTGGCTTTGAACAGGAACTTTCAACCAGCAGGGTCTCTATTCCAATGTGGCCTGTCCAGGTACAGCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------><----------------------------------
I--D--Q--F--D--I--W--N--S--A--S--V--Y--M--D--T--V--D--A--G--N--I--L--R--F--F--A--N--A--F--T--L--T--P
TTGACCAATTTGACATATGGAATTCTGCCTCCGTTTATATGGACACTGTTGATGCCGGCAATATTCTTCGCTTTTTTGCAAATGCATTCACTTTGACACC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------><-----------------------------------------------------------------------------
--Y--N--G--T--E--A--L--V--W--L--F--H--Q--K--P--E--S--V--N--P--L--I--K--Y--L--S--A--T--T--G--F--G--R-
ATATAATGGAACAGAAGCTCTGGTATGGCTTTTCCACCAAAAGCCTGAATCTGTCAATCCTCTGATCAAATATCTGAGTGCCACCACTGGCTTTGGAAGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------><------------------------------------------------------------------------------
-N--Y--I--M--T--Q--K--M--D--L--D--E--D--T--A--E--K--F--Y--Q--K--L--L--E--L--E--K--H--I--R--V--T--I--
AATTACATTATGACCCAGAAGATGGACCTAGATGAAGACACTGCTGAAAAATTTTATCAAAAGTTACTGGAACTGGAAAAGCACATTAGGGTCACTATTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------->
Q--K--T--D--N--Q--A--R--L--S--G--S--C--L--*-
AAAAAACAGATAATCAGGCCAGGCTCAGTGGCTCATGCCTATAA
                                            
--------------------------------------------
--------------------------------------------