Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000149575 (click for geneview)
Transcript ID ENST00000278947(link to ensembl)
Symbol SCN2B
Localtion Chromosome:11:117541414:117552524:-1 band: 11q23.3
Description Sodium channel beta-2 subunit precursor. [Source:Uniprot/SWISSPROT;Acc:O60939]
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<--------------------------------------------------------------------><-----------------------------
-M--H--R--D--A--W--L--P--R--P--A--F--S--L--T--G--L--S--L--F--F--S--L--V--P--P--G--R--S--M--E--V--T--
ATGCACAGAGATGCCTGGCTACCTCGCCCTGCCTTCAGCCTCACGGGGCTCAGTCTCTTTTTCTCTTTGGTGCCACCAGGACGGAGCATGGAGGTCACAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
V--P--A--T--L--N--V--L--N--G--S--D--A--R--L--P--C--T--F--N--S--C--Y--T--V--N--H--K--Q--F--S--L--N--W
TACCTGCCACCCTCAACGTCCTCAATGGCTCTGACGCCCGCCTGCCCTGCACCTTCAACTCCTGCTACACAGTGAACCACAAACAGTTCTCCCTGAACTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------><--------------------------------------------------------------
--T--Y--Q--E--C--N--N--C--S--E--E--M--F--L--Q--F--R--M--K--I--I--N--L--K--L--E--R--F--Q--D--R--V--E-
GACTTACCAGGAGTGCAACAACTGCTCTGAGGAGATGTTCCTCCAGTTCCGCATGAAGATCATTAACCTGAAGCTGGAGCGGTTTCAAGACCGCGTGGAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-F--S--G--N--P--S--K--Y--D--V--S--V--M--L--R--N--V--Q--P--E--D--E--G--I--Y--N--C--Y--I--M--N--P--P--
TTCTCAGGGAACCCCAGCAAGTACGATGTGTCGGTGATGCTGAGAAACGTGCAGCCGGAGGATGAGGGGATTTACAACTGCTACATCATGAACCCCCCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------><---------------------------------------------------
D--R--H--R--G--H--G--K--I--H--L--Q--V--L--M--E--E--P--P--E--R--D--S--T--V--A--V--I--V--G--A--S--V--G
ACCGCCACCGTGGCCATGGCAAGATCCATCTGCAGGTCCTCATGGAAGAGCCCCCTGAGCGGGACTCCACGGTGGCCGTGATTGTGGGTGCCTCCGTCGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--G--F--L--A--V--V--I--L--V--L--M--V--V--K--C--V--R--R--K--K--E--Q--K--L--S--T--D--D--L--K--T--E--E-
GGGCTTCCTGGCTGTGGTCATCTTGGTGCTGATGGTGGTCAAGTGTGTGAGGAGAAAAAAAGAGCAGAAGCTGAGCACAGATGACCTGAAGACCGAGGAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------->
-E--G--K--T--D--G--E--G--N--P--D--D--G--A--K--*-
GAGGGCAAGACGGACGGTGAAGGCAACCCGGATGATGGCGCCAAGTAG
                                                
------------------------------------------------
------------------------------------------------