Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000150051 (click for geneview)
Transcript ID ENST00000279552(link to ensembl)
Symbol NP_775847.1
Localtion Chromosome:10:28001810:28074784:-1 band: 10p12.1
Description  
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--N--T--I--V--F--N--K--L--S--G--A--V--L--F--E--D--G--G--A--S--E--R--E--R--G--G--R--P--Y--S--G--V--
ATGAACACCATCGTCTTCAACAAGCTCAGCGGTGCGGTGCTGTTTGAGGACGGAGGCGCCTCGGAGCGGGAGCGGGGTGGCCGGCCCTACAGCGGTGTCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------------------------------------------><-----------
L--D--S--P--H--A--R--P--E--V--G--I--P--D--G--P--P--L--K--D--N--L--G--L--R--H--R--R--T--G--A--R--Q--N
TGGACAGTCCTCACGCCCGCCCCGAGGTGGGCATTCCCGACGGCCCGCCCCTCAAGGACAACCTCGGCCTGAGACACCGGAGGACCGGCGCCCGGCAGAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--G--G--K--V--R--H--K--R--Q--A--L--Q--D--M--A--R--P--L--K--Q--W--L--Y--K--H--R--D--N--P--Y--P--T--K-
TGGCGGGAAGGTGAGGCACAAGCGGCAGGCCCTGCAAGACATGGCGCGACCCCTCAAGCAGTGGCTTTACAAGCACCGTGACAACCCGTACCCCACCAAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------><---------------------------------------------------
-T--E--K--I--L--L--A--L--G--S--Q--M--T--L--V--Q--V--S--N--W--F--A--N--A--R--R--R--L--K--N--T--V--R--
ACCGAGAAGATACTCTTGGCCCTCGGCTCGCAGATGACGCTAGTGCAGGTGTCAAATTGGTTTGCTAATGCAAGACGTCGGCTTAAGAATACCGTTCGAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
Q--P--D--L--S--W--A--L--R--I--K--L--Y--N--K--Y--V--Q--G--N--A--E--R--L--S--V--S--S--D--D--S--C--S--E
AGCCAGATTTAAGCTGGGCTTTGAGAATAAAGTTATACAACAAGTATGTTCAAGGCAATGCTGAACGGCTTAGCGTAAGCAGTGATGACTCATGTTCTGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-><-------------------------------------------------------------------------------------------------
--D--G--E--N--P--P--R--T--H--M--N--E--G--G--Y--N--T--P--V--H--H--P--V--I--K--S--E--N--S--V--I--K--A-
AGATGGAGAAAATCCTCCAAGAACCCACATGAACGAAGGGGGCTATAATACCCCAGTTCACCATCCTGTGATTAAAAGTGAGAATTCGGTCATCAAAGCG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-G--V--R--P--E--S--R--A--S--E--D--Y--V--A--P--P--K--Y--K--S--S--L--L--N--R--Y--L--N--D--S--L--R--H--
GGAGTGAGGCCAGAGTCACGGGCCAGTGAGGACTACGTGGCACCCCCCAAATACAAGAGCAGCTTGTTGAACCGTTACCTTAATGACTCTTTGAGACATG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
V--M--A--T--N--T--T--M--M--G--K--T--R--Q--R--N--H--S--G--S--F--S--S--N--E--F--E--E--E--L--V--S--P--S
TCATGGCCACGAACACTACCATGATGGGAAAAACAAGGCAAAGAAACCACTCGGGATCTTTTAGCTCCAATGAATTTGAGGAAGAATTAGTGTCTCCATC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------><--------------------------------><---------------------------
--S--S--E--T--E--G--N--F--V--Y--R--T--D--T--L--E--N--G--S--N--K--G--E--S--A--A--N--R--K--G--P--S--K-
GTCATCAGAAACTGAAGGCAACTTTGTCTATCGCACAGACACTCTGGAAAACGGATCCAATAAGGGTGAAAGCGCAGCTAACAGAAAAGGACCAAGCAAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-D--D--T--Y--W--K--E--I--N--A--A--M--A--L--T--N--L--A--Q--G--K--D--K--L--Q--G--T--T--S--C--I--I--Q--
GATGACACGTATTGGAAGGAGATCAACGCAGCTATGGCCTTAACAAATCTTGCACAGGGAAAGGACAAACTGCAGGGAACTACCAGCTGCATCATCCAGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------------->
K--S--S--H--I--A--E--V--K--T--V--K--V--P--L--V--Q--Q--F--*-
AGTCGTCCCATATAGCAGAAGTAAAGACTGTCAAAGTGCCGCTGGTGCAGCAGTTTTAA
                                                           
-----------------------------------------------------------
-----------------------------------------------------------