Sequences
EST Library Info
aor1Aorta
cki1Kidney - RNA from China
csk1Skin - RNA from China
cst1Stomach - RNA from China
dbla1Unavailable
ese1Foetus 50 days, M. semitendinosus
fat1Fatt
hyp1Hypothalamus
jej1Small intestine, jejunum
mga2Mammary gland - 7 days after weaning
nco2Newborn 115 days, colon
nlu1Newborn 115 days, lung
pan1Pancreas
pfco1Unavailable
plac1Unavailable
plun2Unavailable
ret2Retina
sin2Small intestine
ski1Skin
spc2Spinal cord
ssp1M. Supraspinatus
sto3Stomach
thg2Thyroid gland
tra2Trachea
uio2Unavailable
Clusters
Oligos
SNPs

Gene ID ENSG00000143183 (click for geneview)
Transcript ID ENST00000282206(link to ensembl)
Symbol NP_061899.1
Localtion Chromosome:1:162428342:162469752:-1 band: 1q24.1
Description putative membrane protein
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<--------------------------------------------------------------------><-----------------------------
-M--S--T--M--F--A--D--T--L--L--I--V--F--I--S--V--C--T--A--L--L--A--E--G--I--T--W--V--L--V--Y--R--T--
ATGAGCACTATGTTCGCGGACACTCTCCTCATCGTTTTTATCTCTGTGTGCACGGCTCTGCTCGCAGAGGGCATAACCTGGGTCCTGGTTTACAGGACAG
::::::::.:::::::::::::: :: :::::::::::::::::.:::::::::::::::::::: :::   :::::.::::::::::::::::::::::
ATGAGCACCATGTTCGCGGACACACTGCTCATCGTTTTTATCTCCGTGTGCACGGCTCTGCTCGCCGAG---ATAACTTGGGTCCTGGTTTACAGGACAG
-M--S--T--M--F--A--D--T--L--L--I--V--F--I--S--V--C--T--A--L--L--A--E-----I--T--W--V--L--V--Y--R--T--

-----------------------------------------------><---------------------------------------------------
D--K--Y--K--R--L--K--A--E--V--E--K--Q--S--K--K--L--E--K--K--K--E--T--I--T--E--S--A--G--R--Q--Q--K--K
ACAAGTACAAGAGACTGAAGGCAGAAGTGGAAAAACAGAGTAAAAAATTGGAAAAGAAGAAGGAAACAATAACAGAGTCAGCTGGTCGACAACAGAAAAA
:::::::::::::::::::::::::::::::::::::::::::::::                                                     
ACAAGTACAAGAGACTGAAGGCAGAAGTGGAAAAACAGAGTAAAAAA-----------------------------------------------------
D--K--Y--K--R--L--K--A--E--V--E--K--Q--S--K--K------------------------------------------------------

-------><---------------------------------------------><--------------------------------------------
--K--I--E--R--Q--E--E--K--L--K--N--N--N--R--D--L--S--M--V--R--M--K--S--M--F--A--I--G--F--C--F--T--A-
GAAAATAGAGAGACAAGAAGAGAAACTGAAGAATAACAACAGAGATCTATCAATGGTTCGAATGAAATCCATGTTTGCTATTGGCTTTTGTTTTACTGCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------><----------------------------------------------------------------------------
-L--M--G--M--F--N--S--I--F--D--G--R--V--V--A--K--L--P--F--T--P--L--S--Y--I--Q--G--L--S--H--R--N--L--
CTAATGGGAATGTTCAATTCCATATTTGATGGTAGAGTGGTGGCAAAGCTTCCTTTTACCCCTCTTTCTTACATCCAAGGACTGTCTCATCGAAATCTGC
                        ::::::::::::::::::::::::::.:::::.:::::.:::::.::::: ::::::::::::::: :::::::::
------------------------TTTGATGGTAGAGTGGTGGCAAAGCTCCCTTTCACCCCCCTTTCCTACATGCAAGGACTGTCTCATAGAAATCTGC
-------------------------F--D--G--R--V--V--A--K--L--P--F--T--P--L--S--Y--M--Q--G--L--S--H--R--N--L--

-------------------------------------------------------------------><-------------------------------
L--G--D--D--T--T--D--C--S--F--I--F--L--Y--I--L--C--T--M--S--I--R--Q--N--I--Q--K--I--L--G--L--A--P--S
TGGGAGATGACACCACAGACTGTTCCTTCATTTTCCTGTATATTCTCTGTACTATGTCGATTCGACAGAACATTCAGAAGATTCTCGGCCTTGCCCCTTC
:::::::::::::::::::::::::::::::.::::::::::::::::::::.:::::.::::::::::::::.:::::::::::.:::::.::::::::
TGGGAGATGACACCACAGACTGTTCCTTCATCTTCCTGTATATTCTCTGTACCATGTCAATTCGACAGAACATCCAGAAGATTCTTGGCCTCGCCCCTTC
L--G--D--D--T--T--D--C--S--F--I--F--L--Y--I--L--C--T--M--S--I--R--Q--N--I--Q--K--I--L--G--L--A--P--S

------------------------------------------------------------------>
--R--A--A--T--K--Q--A--G--G--F--L--G--P--P--P--P--S--G--K--F--S--*-
ACGAGCCGCCACCAAGCAGGCAGGTGGATTTCTTGGCCCACCACCTCCTTCTGGGAAGTTCTCTTGA
::::::.:::::::::::::::::::::::::::::::: :::::::::::::::::::::::::::
ACGAGCTGCCACCAAGCAGGCAGGTGGATTTCTTGGCCCTCCACCTCCTTCTGGGAAGTTCTCTTGA
--R--A--A--T--K--Q--A--G--G--F--L--G--P--P--P--P--S--G--K--F--S--*-

Pig Consensus Sequence

>BGISUST0000886245
ATGAGCACCATGTTCGCGGACACACTGCTCATCGTTTTTATCTCCGTGTGCACGGCTCTGCTCGCCGAG---ATAACTTGGGTCCTGGTTTACAGGACAG
ACAAGTACAAGAGACTGAAGGCAGAAGTGGAAAAACAGAGTAAAAAA-----------------------------------------------------
----------------------------------------------------------------------------------------------------
------------------------TTTGATGGTAGAGTGGTGGCAAAGCTCCCTTTCACCCCCCTTTCCTACATGCAAGGACTGTCTCATAGAAATCTGC
TGGGAGATGACACCACAGACTGTTCCTTCATCTTCCTGTATATTCTCTGTACCATGTCAATTCGACAGAACATCCAGAAGATTCTTGGCCTCGCCCCTTC
ACGAGCTGCCACCAAGCAGGCAGGTGGATTTCTTGGCCCTCCACCTCCTTCTGGGAAGTTCTCTTGA


>BGISUSP0000886245
MSTMFADTLLIVFISVCTALLAE-ITWVLVYRTDKYKRLKAEVEKQSKK---------------------------------------------------
--------FDGRVVAKLPFTPLSYMQGLSHRNLLGDDTTDCSFIFLYILCTMSIRQNIQKILGLAPSRAATKQAGGFLGPPPPSGKFS*