Sequences
EST Library Info
csp1Spleen - RNA from China
Clusters
Oligos
SNPs

Gene ID ENSG00000169896 (click for geneview)
Transcript ID ENST00000287497(link to ensembl)
Symbol ITGAM
Localtion Chromosome:16:31168413:31251702:1 band: 16p11.2
Description Integrin alpha-M precursor (Cell surface glycoprotein MAC-1 alpha subunit) (CR-3 alpha chain) (CD11b) (Leukocyte adhesion receptor MO1) (Neutrophil adherence receptor). [Source:Uniprot/SWISSPROT;Acc:P11215]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-----------------------><--------------------------------------------------------------------------
-V--L--R--V--M--I--M--I--S--L--T--L--C--H--G--F--N--L--D--T--E--N--A--M--T--F--Q--E--N--A--R--G--F--
GTGCTTAGAGTAATGATAATGATATCCTTGACCTTATGTCATGGGTTCAACTTGGACACTGAAAACGCAATGACCTTCCAAGAGAACGCAAGGGGCTTCG
                           :::.::::: ::::::::::::::.::::::: :::::.:::.: ..::::::.::.::.::::. :::::::
---------------------------TTGGCCTTAAGTCATGGGTTCAACCTGGACACGGAAAATGCAGTCGTCTTCCAGGAAAATGCAAATGGCTTCG
----------------------------L--A--L--S--H--G--F--N--L--D--T--E--N--A--V--V--F--Q--E--N--A--N--G--F--

------------------------------><--------------------------------------------------------------------
G--Q--S--V--V--Q--L--Q--G--S--R--V--V--V--G--A--P--Q--E--I--V--A--A--N--Q--R--G--S--L--Y--Q--C--D--Y
GGCAGAGCGTGGTCCAGCTTCAGGGATCCAGGGTGGTGGTTGGAGCCCCCCAGGAGATAGTGGCTGCCAACCAAAGGGGCAGCCTCTACCAGTGCGACTA
:::::::::::::::::::  ::::.                                                                          
GGCAGAGCGTGGTCCAGCTGGAGGGG--------------------------------------------------------------------------
G--Q--S--V--V--Q--L--E--G---------------------------------------------------------------------------

----------------------------------><----------------------------------------------------------------
--S--T--G--S--C--E--P--I--R--L--Q--V--P--V--E--A--V--N--M--S--L--G--L--S--L--A--A--T--T--S--P--P--Q-
CAGCACAGGCTCATGCGAGCCCATCCGCCTGCAGGTCCCCGTGGAGGCCGTGAACATGTCCCTGGGCCTGTCCCTGGCAGCCACCACCAGCCCCCCTCAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----><---------------------------------------------------------------------------------------------
-L--L--A--C--G--P--T--V--H--Q--T--C--S--E--N--T--Y--V--K--G--L--C--F--L--F--G--S--N--L--R--Q--Q--P--
CTGCTGGCCTGTGGTCCCACCGTGCACCAGACTTGCAGTGAGAACACGTATGTGAAAGGGCTCTGCTTCCTGTTTGGATCCAACCTACGGCAGCAGCCCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------><---------------------------------------------------------------------------
Q--K--F--P--E--A--L--R--G--C--P--Q--E--D--S--D--I--A--F--L--I--D--G--S--G--S--I--I--P--H--D--F--R--R
AGAAGTTCCCAGAGGCCCTCCGAGGGTGTCCTCAAGAGGATAGTGACATTGCCTTCTTGATTGATGGCTCTGGTAGCATCATCCCACATGACTTTCGGCG
                          ::.:::::. :.:: ::::::::::::::.:::::::::::.::.:::::::::: :: ..  :::::::.:::
--------------------------TGCCCTCAGCAAGAGAGTGACATTGCCTTTTTGATTGATGGTTCCGGTAGCATCAACCGGTTAGACTTTCAGCG
---------------------------C--P--Q--Q--E--S--D--I--A--F--L--I--D--G--S--G--S--I--N--R--L--D--F--Q--R

------------------------------------------------------><--------------------------------------------
--M--K--E--F--V--S--T--V--M--E--Q--L--K--K--S--K--T--L--F--S--L--M--Q--Y--S--E--E--F--R--I--H--F--T-
GATGAAGGAGTTTGTCTCAACTGTGATGGAGCAATTAAAAAAGTCCAAAACCTTGTTCTCTTTGATGCAGTACTCTGAAGAATTCCGGATTCACTTTACC
:::::::::::::::::: ::::::::::. :::::  :::::::::::::::::                                             
GATGAAGGAGTTTGTCTCCACTGTGATGGGTCAATTCCAAAAGTCCAAAACCTTG---------------------------------------------
--M--K--E--F--V--S--T--V--M--G--Q--F--Q--K--S--K--T--L----------------------------------------------

----------------------------------------------------------------------------------------------------
-F--K--E--F--Q--N--N--P--N--P--R--S--L--V--K--P--I--T--Q--L--L--G--R--T--H--T--A--T--G--I--R--K--V--
TTCAAAGAGTTCCAGAACAACCCTAACCCAAGATCACTGGTGAAGCCAATAACGCAGCTGCTTGGGCGGACACACACGGCCACGGGCATCCGCAAAGTGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

><--------------------------------------------------------------------------------------------------
V--R--E--L--F--N--I--T--N--G--A--R--K--N--A--F--K--I--L--V--V--I--T--D--G--E--K--F--G--D--P--L--G--Y
TACGAGAGCTGTTTAACATCACCAACGGAGCCCGAAAGAATGCCTTTAAGATCCTAGTTGTCATCACGGATGGAGAAAAGTTTGGCGATCCCTTGGGATA
     ::.:::::: ::: ::  :..::::::::..::::::::.:::::::::::::::::::::::::.:::::::::::.::::::::.::::::::
-----GAACTGTTTCACAGCAAGAGTGGAGCCCGGGAGAATGCCCTTAAGATCCTAGTTGTCATCACGGACGGAGAAAAGTTCGGCGATCCTTTGGGATA
------E--L--F--H--S--K--S--G--A--R--E--N--A--L--K--I--L--V--V--I--T--D--G--E--K--F--G--D--P--L--G--Y

------------------------------------------------------><--------------------------------------------
--E--D--V--I--P--E--A--D--R--E--G--V--I--R--Y--V--I--G--V--G--D--A--F--R--S--E--K--S--R--Q--E--L--N-
TGAGGATGTCATCCCTGAGGCAGACAGAGAGGGAGTCATTCGCTACGTCATTGGGGTGGGAGATGCCTTCCGCAGTGAGAAATCCCGCCAAGAGCTTAAT
::::::::::::::::::.::.::.:::.:::: :::::::::::::::::.:::      ::::::::: .:::: .::::::.::. :.:::::::::
TGAGGATGTCATCCCTGAAGCGGATAGAAAGGGCGTCATTCGCTACGTCATCGGG------GATGCCTTCAACAGTTGGAAATCTCGTGAGGAGCTTAAT
--E--D--V--I--P--E--A--D--R--K--G--V--I--R--Y--V--I--G--------D--A--F--N--S--W--K--S--R--E--E--L--N-

----------------------------------------------------------------------------------------------------
-T--I--A--S--K--P--P--R--D--H-----V--F--Q-----V--N--N--F--E--A--L--K--T--I--Q--N--Q--L--R--E--K-----
ACCATCGCATCCAAGCCGCCTCGTGATCAC---GTGTTCCAG---GTGAATAACTTTGAGGCTCTGAAGACCATTCAGAACCAGCTTCGGGAGAAG---A
::::: ::::::::::::.:: ::::::::   :::::::::   :::: :::::::::.::::::::::::::::::::::::::::.:::.:::    
ACCATGGCATCCAAGCCGTCTGGTGATCACT--GTGTTCCAGT--GTGACTAACTTTGAAGCTCTGAAGACCATTCAGAACCAGCTTCAGGAAAAGA--T
-T--M--A--S--K--P--S--G--D--H--\--V--F--Q--\--V--T--N--F--E--A--L--K--T--I--Q--N--Q--L--Q--E--K--\--

--------------><------------------------------------------------------------------------><----------
I--F--A--I--E--G--T--Q--T--G--S--S--S--S--F--E--H--E--M--S--Q--E--G--F--S--A--A--I--T--S--N--G--P--L
TCTTTGCGATCGAGGGTACTCAGACAGGAAGTAGCAGCTCCTTTGAGCATGAGATGTCTCAGGAAGGCTTCAGCGCTGCCATCACCTCTAATGGCCCCTT
 :::::::::.:::      ::::::::::::: :::::::::::::.:::::::::::::::::::::::::.:: ::::::::::::           
GCTTTGCGATTGAG------CAGACAGGAAGTACCAGCTCCTTTGAGTATGAGATGTCTCAGGAAGGCTTCAGTGCAGCCATCACCTCT-----------
I--F--A--I--E--------Q--T--G--S--T--S--S--F--E--Y--E--M--S--Q--E--G--F--S--A--A--I--T--S------------

----------------------------------------------------------------------------------------------------
--L--S--T--V--G--S--Y--D--W--A--G--G--V--F--L--Y--T--S--K--E--K--S--T--F--I--N--M--T--R--V--D--S--D-
GCTGAGCACTGTGGGGAGCTATGACTGGGCTGGTGGAGTCTTTCTATATACATCAAAGGAGAAAAGCACCTTCATCAACATGACCAGAGTGGATTCAGAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------><--------------------------------------------------------------------------------
-M--N--D--A--Y--L--G--Y--A--A--A--I--I--L--R--N--R--V--Q--S--L--V--L--G--A--P--R--Y--Q--H--I--G--L--
ATGAATGATGCTTACTTGGGTTATGCTGCCGCCATCATCTTACGGAACCGGGTGCAAAGCCTGGTTCTGGGGGCACCTCGATATCAGCACATCGGCCTGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------><-------------------------------------
V--A--M--F--R--Q--N--T--G--M--W--E--S--N--A--N--V--K--G--T--Q--I--G--A--Y--F--G--A--S--L--C--S--V--D
TAGCGATGTTCAGGCAGAACACTGGCATGTGGGAGTCCAACGCTAATGTCAAGGGCACCCAGATCGGCGCCTACTTCGGGGCCTCCCTCTGCTCCGTGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--V--D--S--N--G--S--T--D--L--V--L--I--G--A--P--H--Y--Y--E--Q--T--R--G--G--Q--V--S--V--C--P--L--P--R-
CGTGGACAGCAACGGCAGCACCGACCTGGTCCTCATCGGGGCCCCCCATTACTACGAGCAGACCCGAGGGGGCCAGGTGTCCGTGTGCCCCTTGCCCAGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--><------------------------------------------------------------------------------------------------
-G--R--A--R--W--Q--C--D--A--V--L--Y--G--E--Q--G--Q--P--W--G--R--F--G--A--A--L--T--V--L--G--D--V--N--
GGGAGGGCTCGGTGGCAGTGTGATGCTGTTCTCTACGGGGAGCAGGGCCAACCCTGGGGCCGCTTTGGGGCAGCCCTAACAGTGCTGGGGGACGTAAATG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
G--D--K--L--T--D--V--A--I--G--A--P--G--E--E--D--N--R--G--A--V--Y--L--F--H--G--T--S--G--S--G--I--S--P
GGGACAAGCTGACGGACGTGGCCATTGGGGCCCCAGGAGAGGAGGACAACCGGGGTGCTGTTTACCTGTTTCACGGAACCTCAGGATCTGGCATCAGCCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------><--------------------------------------------------------------------------------------
--S--H--S--Q--R--I--A--G--S--K--L--S--P--R--L--Q--Y--F--G--Q--S--L--S--G--G--Q--D--L--T--M--D--G--L-
CTCCCATAGCCAGCGGATAGCAGGCTCCAAGCTCTCTCCCAGGCTCCAGTATTTTGGTCAGTCACTGAGTGGGGGCCAGGACCTCACAATGGATGGACTG
             ::: : ::::::::: :::::::.:::::::::::::::::.:  :. ::.::::::::::::::::::::::: ::::::::::::
-------------CGGTTCGCAGGCTCCCAGCTCTCCCCCAGGCTCCAGTATTTCGCACGTTCGCTGAGTGGGGGCCAGGACCTCACCATGGATGGACTG
--------------R--F--A--G--S--Q--L--S--P--R--L--Q--Y--F--A--R--S--L--S--G--G--Q--D--L--T--M--D--G--L-

-------------------------------------------><-------------------------------------------------------
-V--D--L--T--V--G--A--Q--G--H--V--L--L--L--R--S--Q--P--V--L--R--V--K--A--I--M--E--F--N--P--R--E--V--
GTAGACCTGACTGTAGGAGCCCAGGGGCACGTGCTGCTGCTCAGGTCCCAGCCAGTACTGAGAGTCAAGGCAATCATGGAGTTCAATCCCAGGGAAGTGG
::.:::.:: :.::.::.:::::::::::.:..:::::::::                                                          
GTGGACTTGTCCGTGGGGGCCCAGGGGCATGCACTGCTGCTC----------------------------------------------------------
-V--D--L--S--V--G--A--Q--G--H--A--L--L--L-----------------------------------------------------------

----------------------------------------------------------------------------------------------------
A--R--N--V--F--E--C--N--D--Q--V--V--K--G--K--E--A--G--E--V--R--V--C--L--H--V--Q--K--S--T--R--D--R--L
CAAGGAATGTATTTGAGTGTAATGATCAGGTGGTGAAAGGCAAGGAAGCCGGAGAGGTCAGAGTCTGCCTCCATGTCCAGAAGAGCACACGGGATCGGCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------><-------------------------------------------------------------------------------------------
--R--E--G--Q--I--Q--S--V--V--T--Y--D--L--A--L--D--S--G--R--P--H--S--R--A--V--F--N--E--T--K--N--S--T-
AAGAGAAGGACAGATCCAGAGTGTTGTGACTTATGACCTGGCTCTGGACTCCGGCCGCCCACATTCCCGCGCCGTCTTCAATGAGACAAAGAACAGCACA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------><------------------------------------
-R--R--Q--T--Q--V--L--G--L--T--Q--T--C--E--T--L--K--L--Q--L--P--N--C--I--E--D--P--V--S--P--I--V--L--
CGCAGACAGACACAGGTCTTGGGGCTGACCCAGACTTGTGAGACCCTGAAACTACAGTTGCCGAATTGCATCGAGGACCCAGTGAGCCCCATTGTGCTGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------><----
R--L--N--F--S--L--V--G--T--P--L--S--A--F--G--N--L--R--P--V--L--A--E--D--A--Q--R--L--F--T--A--L--F--P
GCCTGAACTTCTCTCTGGTGGGAACGCCATTGTCTGCTTTCGGGAACCTCCGGCCAGTGCTGGCGGAGGATGCTCAGAGACTCTTCACAGCCTTGTTTCC
                                                                                                  ::
--------------------------------------------------------------------------------------------------CC
---------------------------------------------------------------------------------------------------P

--------------------------------------------------------------------><------------------------------
--F--E--K--N--C--G--N--D--N--I--C--Q--D--D--L--S--I--T--F--S--F--M--S--L--D--C--L--V--V--G--G--P--R-
CTTTGAGAAGAATTGTGGCAATGACAACATCTGCCAGGATGACCTCAGCATCACCTTCAGTTTCATGAGCCTGGACTGCCTCGTGGTGGGTGGGCCCCGG
:::.:::::::::::.::::::::::.:::::::::::::::::: :::::::::::::::::. ::   ::::::  ::: ::::::::::: ::.:::
CTTCGAGAAGAATTGCGGCAATGACAGCATCTGCCAGGATGACCTGAGCATCACCTTCAGTTTTCTG---CTGGACACCCTGGTGGTGGGTGGTCCTCGG
--F--E--K--N--C--G--N--D--S--I--C--Q--D--D--L--S--I--T--F--S--F--L-----L--D--T--L--V--V--G--G--P--R-

----------------------------------------------------------------------------------------------------
-E--F--N--V--T--V--T--V--R--N--D--G--E--D--S--Y--R--T--Q--V--T--F--F--F--P--L--D--L--S--Y--R--K--V--
GAGTTCAACGTGACAGTGACTGTGAGAAATGATGGTGAGGACTCCTACAGGACACAGGTCACCTTCTTCTTCCCGCTTGACCTGTCCTACCGGAAGGTGT
:: :: :: :::::  ::::.::::::::    ::.::::::::::::::.:: :::::::::::::::: ::::..::.:.:::::::.::::::::::
GACTTAAAAGTGACCCTGACCGTGAGAAAACCAGGCGAGGACTCCTACAGAACTCAGGTCACCTTCTTCTACCCGTCTGGCTTGTCCTATCGGAAGGTGT
-D--L--K--V--T--L--T--V--R--K--P--G--E--D--S--Y--R--T--Q--V--T--F--F--Y--P--S--G--L--S--Y--R--K--V--

----------><----------------------------------------------------------------------------------------
S--T--L--Q--N--Q--R--S--Q--R--S--W--R--L--A--C--E--S--A--S--S--T--E--V--S--G--A--L--K--S--T--S--C--S
CCACGCTCCAGAACCAGCGCTCACAGCGATCCTGGCGCCTGGCCTGTGAGTCTGCCTCCTCCACCGAAGTGTCTGGGGCCTTGAAGAGCACCAGCTGCAG
:                                                                                                   
CA--------------------------------------------------------------------------------------------------
S---------------------------------------------------------------------------------------------------

---------------------------------><-----------------------------------------------------------------
--I--N--H--P--I--F--P--E--N--S--E--V--T--F--N--I--T--F--D--V--D--S--K--A--S--L--G--N--K--L--L--L--K-
CATAAACCACCCCATCTTCCCGGAAAACTCAGAGGTCACCTTTAATATCACGTTTGATGTAGACTCTAAGGCTTCCCTTGGAAACAAACTGCTCCTCAAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------><----------------------------------------------------------------------------------><-
-A--N--V--T--S--E--N--N--M--P--R--T--N--K--T--E--F--Q--L--E--L--P--V--K--Y--A--V--Y--M--V--V--T--S--
GCCAATGTGACCAGTGAGAACAACATGCCCAGAACCAACAAAACCGAATTCCAACTGGAGCTGCCGGTGAAATATGCTGTCTACATGGTGGTCACCAGCC
               ::::::::::::::::: : ::::::::::::::::::.::::::::::: ::::::::.:::::::::.:::::::.:::    
---------------GAGAACAACATGCCCAGCAGCAACAAAACCGAATTCCAGCTGGAGCTGCCTGTGAAATACGCTGTCTACGTGGTGGTTACC----
----------------E--N--N--M--P--S--S--N--K--T--E--F--Q--L--E--L--P--V--K--Y--A--V--Y--V--V--V--T-----

-------------------------------------------------------------------------><-------------------------
H--G--V--S--T--K--Y--L--N--F--T--A--S--E--N--T--S--R--V--M--Q--H--Q--Y--Q--V--S--N--L--G--Q--R--S--L
ATGGGGTCTCCACTAAATATCTCAACTTCACGGCCTCAGAGAATACCAGTCGGGTCATGCAGCATCAATATCAGGTCAGCAACCTGGGGCAGAGGAGCCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------------------------------------><-----------------
--P--I--S--L--V--F--L--V--P--V--R--L--N--Q--T--V--I--W--D--R--P--Q--V--T--F--S--E--N--L--S--S--T--C-
CCCCATCAGCCTGGTGTTCTTGGTGCCCGTCCGGCTGAACCAGACTGTCATATGGGACCGCCCCCAGGTCACCTTCTCCGAGAACCTCTCGAGTACGTGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------------------------><---------------------------------
-H--T--K--E--R--L--P--S--H--S--D--F--L--A--E--L--R--K--A--P--V--V--N--C--S--I--A--V--C--Q--R--I--Q--
CACACCAAGGAGCGCTTGCCCTCTCACTCCGACTTTCTGGCTGAGCTTCGGAAGGCCCCCGTGGTGAACTGCTCCATCGCTGTCTGCCAGAGAATCCAGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------------------------><-------------------
C--D--I--P--F--F--G--I--Q--E--E--F--N--A--T--L--K--G--N--L--S--F--D--W--Y--I--K--T--S--H--N--H--L--L
GTGACATCCCGTTCTTTGGCATCCAGGAAGAATTCAATGCTACCCTCAAAGGCAACCTCTCGTTTGACTGGTACATCAAGACCTCGCATAACCACCTCCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------------------------------------><-----------------
--I--V--S--T--A--E--I--L--F--N--D--S--V--F--T--L--L--P--G--Q--G--A--F--V--R--S--Q--T--E--T--K--V--E-
GATCGTGAGCACAGCTGAGATCTTGTTTAACGATTCCGTGTTCACCCTGCTGCCGGGACAGGGGGCGTTTGTGAGGTCCCAGACGGAGACCAAAGTGGAG
                                                                                  ::.:::::::::::::::
----------------------------------------------------------------------------------ACAGAGACCAAAGTGGAG
-----------------------------------------------------------------------------------T--E--T--K--V--E-

--------------------------------------------------------------------------------------------><------
-P--F--E--V--P--N--P--L--P--L--I--V--G--S--S--V--G--G--L--L--L--L--A--L--I--T--A--A--L--Y--K--L--G--
CCGTTCGAGGTCCCCAACCCCCTGCCGCTCATCGTGGGCAGCTCTGTCGGGGGACTGCTGCTCCTGGCCCTCATCACCGCCGCGCTGTACAAGCTCGGCT
:::: :::.:: : .:::::.:: ::.:::::::::::::::                                                          
CCGTACGAAGTGCATAACCCTCTCCCACTCATCGTGGGCAGC----------------------------------------------------------
-P--Y--E--V--H--N--P--L--P--L--I--V--G--S-----------------------------------------------------------

---------------------------------------------------------------->
F--F--K--R--Q--Y--K--D--M--M--S--E--G--G--P--P--G--A--E--P--Q--*-
TCTTCAAGCGGCAATACAAGGACATGATGAGTGAAGGGGGTCCCCCGGGGGCCGAACCCCAGTAG
                                                                 
-----------------------------------------------------------------
-----------------------------------------------------------------

Pig Consensus Sequence

>BGISUST0000883140
---------------------------TTGGCCTTAAGTCATGGGTTCAACCTGGACACGGAAAATGCAGTCGTCTTCCAGGAAAATGCAAATGGCTTCG
GGCAGAGCGTGGTCCAGCTGGAGGGG--------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
--------------------------TGCCCTCAGCAAGAGAGTGACATTGCCTTTTTGATTGATGGTTCCGGTAGCATCAACCGGTTAGACTTTCAGCG
GATGAAGGAGTTTGTCTCCACTGTGATGGGTCAATTCCAAAAGTCCAAAACCTTG---------------------------------------------
----------------------------------------------------------------------------------------------------
-----GAACTGTTTCACAGCAAGAGTGGAGCCCGGGAGAATGCCCTTAAGATCCTAGTTGTCATCACGGACGGAGAAAAGTTCGGCGATCCTTTGGGATA
TGAGGATGTCATCCCTGAAGCGGATAGAAAGGGCGTCATTCGCTACGTCATCGGG------GATGCCTTCAACAGTTGGAAATCTCGTGAGGAGCTTAAT
ACCATGGCATCCAAGCCGTCTGGTGATCAcgTGTTCCAggTGACTAACTTTGAAGCTCTGAAGACCATTCAGAACCAGCTTCAGGAAAAgtGCTTTGCGA
TTGAG------CAGACAGGAAGTACCAGCTCCTTTGAGTATGAGATGTCTCAGGAAGGCTTCAGTGCAGCCATCACCTCT--------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----CGGTTCGCAGGCTCCCAGCTCTCCCCCAGGCTCCAGTATTTCGCACGTTCGCTGAGTGGGGGCCAGGACCTCACCATGGATGGACTGGTGGACTTG
TCCGTGGGGGCCCAGGGGCATGCACTGCTGCTC-------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
-----------------------------------------------------------------------------------------CCCTTCGAGAA
GAATTGCGGCAATGACAGCATCTGCCAGGATGACCTGAGCATCACCTTCAGTTTTCTG---CTGGACACCCTGGTGGTGGGTGGTCCTCGGGACTTAAAA
GTGACCCTGACCGTGAGAAAACCAGGCGAGGACTCCTACAGAACTCAGGTCACCTTCTTCTACCCGTCTGGCTTGTCCTATCGGAAGGTGTCA-------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
------GAGAACAACATGCCCAGCAGCAACAAAACCGAATTCCAGCTGGAGCTGCCTGTGAAATACGCTGTCTACGTGGTGGTTACC-------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
-------------------------------------------------------------------------ACAGAGACCAAAGTGGAGCCGTACGAA
GTGCATAACCCTCTCCCACTCATCGTGGGCAGC-------------------------------------------------------------------
--------------------------------------------------------


>BGISUSP0000883140
---------LALSHGFNLDTENAVVFQENANGFGQSVVQLEG----------------------------------------------------------
------------------------------------------CPQQESDIAFLIDGSGSINRLDFQRMKEFVSTVMGQFQKSKTL---------------
-----------------------------------ELFHSKSGARENALKILVVITDGEKFGDPLGYEDVIPEADRKGVIRYVIG--DAFNSWKSREELN
TMASKPSGDHVFQVTNFEALKTIQNQLQEKCFAIE--QTGSTSSFEYEMSQEGFSAAITS----------------------------------------
----------------------------------------------------------------------------------------------------
--------------------------------------------------------------------RFAGSQLSPRLQYFARSLSGGQDLTMDGLVDL
SVGAQGHALLL-----------------------------------------------------------------------------------------
---------------------------------------------------------------PFEKNCGNDSICQDDLSITFSFL-LDTLVVGGPRDLK
VTLTVRKPGEDSYRTQVTFFYPSGLSYRKVS---------------------------------------------------------------------
--ENNMPSSNKTEFQLELPVKYAVYVVVT-----------------------------------------------------------------------
-------------------------------------------------------------------------------------------TETKVEPYE
VHNPLPLIVGS-----------------------------------------