Sequences
CT382677reads
CV865384est
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000157330 (click for geneview)
Transcript ID ENST00000288048(link to ensembl)
Symbol NP_689503.1
Localtion Chromosome:1:12740433:12758109:1 band: 1p36.21
Description hypothetical protein MGC35194
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--F--L--T--A--V--N--P--Q--P--L--S--T--P--S--W--Q--I--E--T--K--Y--S--T--K--V--L--T--G--N--W--M--E--
ATGTTTTTGACTGCAGTAAATCCACAGCCACTCTCTACTCCGAGCTGGCAGATTGAGACCAAGTATTCAACGAAAGTGCTCACTGGAAATTGGATGGAAG
   : ::: :. ::::::::.:: :::.::.::::.:::::.:::::: ::.::::::::::::::::.:: :.:::::::::::::::.:::.::::.:
---TATTTCATGGCAGTAAACCCTCAGTCATTCTCCACTCCAAGCTGGAAGGTTGAGACCAAGTATTCGACCAGAGTGCTCACTGGAAACTGGGTGGAGG
----Y--F--M--A--V--N--P--Q--S--F--S--T--P--S--W--K--V--E--T--K--Y--S--T--R--V--L--T--G--N--W--V--E--

----------><----------------------------------------------------------------------------------------
E--R--R--K--F--T--R--D--T--D--K--T--P--Q--S--I--Y--R--K--E--Y--I--P--F--P--D--H--R--P--D--Q--I--S--R
AGAGGAGAAAGTTCACCAGAGACACTGACAAGACACCCCAATCCATTTACAGAAAAGAATACATCCCCTTCCCAGACCACAGACCAGACCAGATCTCCAG
:::::::.::::::::.:.:: :::::: ::::: :::::.  :::::::::::::::.:::.:.::::::::::.::::::::: ::::::::::::::
AGAGGAGGAAGTTCACTAAAGCCACTGAGAAGACCCCCCAGAGCATTTACAGAAAAGAGTACGTTCCCTTCCCAGGCCACAGACCCGACCAGATCTCCAG
E--R--R--K--F--T--K--A--T--E--K--T--P--Q--S--I--Y--R--K--E--Y--V--P--F--P--G--H--R--P--D--Q--I--S--R

------------------------><--------------------------------------------------------------------------
--W--Y--G--K--R--K--V--E--G--L--P--Y--K--H--L--I--T--H--H--Q--E--P--P--H--R--Y--L--I--S--T--Y--D--D-
GTGGTATGGGAAGAGGAAAGTTGAGGGGCTACCTTACAAACACCTGATCACCCACCACCAGGAGCCCCCACATCGCTACCTGATCAGCACCTATGACGAC
::::::..: :::::::.:::::::::::: :: :::::::::::::::::::::::::::::::::.:.::.:.:.:.:::::::::::::::::.:::
GTGGTACAGCAAGAGGAGAGTTGAGGGGCTCCCGTACAAACACCTGATCACCCACCACCAGGAGCCCTCGCACCACCATCTGATCAGCACCTATGATGAC
--W--Y--S--K--R--R--V--E--G--L--P--Y--K--H--L--I--T--H--H--Q--E--P--S--H--H--H--L--I--S--T--Y--D--D-

----------------------------------------------------------------------------------------------------
-H--Y--N--R--H--G--Y--N--P--G--L--P--P--L--R--T--W--N--G--Q--K--L--L--W--L--P--E--K--S--D--F--P--L--
CATTACAACCGGCATGGTTACAACCCGGGGCTGCCTCCACTCCGCACTTGGAATGGACAGAAGTTGCTGTGGCTGCCAGAGAAGTCTGACTTTCCCCTTC
::::::::::::::....::.:::::::: ::.::.:. :::::::: ::::::..::: :::::::::::::: ::::::::. :.:::::.: ::: :
CATTACAACCGGCACAACTATAACCCGGGCCTACCCCTCCTCCGCACGTGGAATAAACATAAGTTGCTGTGGCTCCCAGAGAAAGCCGACTTCCACCTGC
-H--Y--N--R--H--N--Y--N--P--G--L--P--L--L--R--T--W--N--K--H--K--L--L--W--L--P--E--K--A--D--F--H--L--

--><------------------------------------------------------------------------------------------------
L--A--P--P--T--N--Y--G--L--Y--E--Q--L--K--Q--R--Q--L--T--P--K--A--G--L--K--Q--S--T--Y--T--S--S--Y--P
TTGCTCCCCCTACAAACTATGGACTCTATGAGCAGCTCAAGCAGAGACAGCTCACACCCAAGGCTGGCCTGAAGCAGAGCACTTATACTTCATCCTACCC
::                                                                                                  
TT--------------------------------------------------------------------------------------------------
L---------------------------------------------------------------------------------------------------

------------------------------------------------------------------------------------>
--R--P--P--L--C--A--M--S--W--R--E--H--A--V--P--V--P--P--H--R--L--H--P--F--P--H--F--*-
CAGACCACCGTTGTGCGCTATGTCCTGGAGGGAGCATGCGGTCCCGGTCCCTCCCCATCGCCTGCATCCTTTCCCACACTTCTGA
                                                                                     
-------------------------------------------------------------------------------------
-------------------------------------------------------------------------------------

Pig Consensus Sequence

>BGISUST0000890722
---TATTTCATGGCAGTAAACCCTCAGTCATTCTCCACTCCAAGCTGGAAGGTTGAGACCAAGTATTCGACCAGAGTGCTCACTGGAAACTGGGTGGAGG
AGAGGAGGAAGTTCACTAAAGCCACTGAGAAGACCCCCCAGAGCATTTACAGAAAAGAGTACGTTCCCTTCCCAGGCCACAGACCCGACCAGATCTCCAG
GTGGTACAGCAAGAGGAGAGTTGAGGGGCTCCCGTACAAACACCTGATCACCCACCACCAGGAGCCCTCGCACCACCATCTGATCAGCACCTATGATGAC
CATTACAACCGGCACAACTATAACCCGGGCCTACCCCTCCTCCGCACGTGGAATAAACATAAGTTGCTGTGGCTCCCAGAGAAAGCCGACTTCCACCTGC
TT--------------------------------------------------------------------------------------------------
-------------------------------------------------------------------------------------


>BGISUSP0000890722
-YFMAVNPQSFSTPSWKVETKYSTRVLTGNWVEERRKFTKATEKTPQSIYRKEYVPFPGHRPDQISRWYSKRRVEGLPYKHLITHHQEPSHHHLISTYDD
HYNRHNYNPGLPLLRTWNKHKLLWLPEKADFHLL-------------------------------------------------------------