Sequences
EST Library Info
ebs1Foetus 50 days, brain stem
Clusters
Oligos
SNPs

Gene ID ENSG00000158792 (click for geneview)
Transcript ID ENST00000289805(link to ensembl)
Symbol NP_689552.2
Localtion Chromosome:16:88290258:88295604:-1 band: 16q24.3
Description hypothetical protein MGC26885
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--G--S--S--S--L--S--E--D--Y--R--Q--C--L--E--R--E--L--R--R--G--R--A--G--V--C--G--D--P--S--L--R--A--
ATGGGCAGCAGCTCGCTGTCCGAGGACTACCGCCAGTGCCTGGAGCGCGAGCTGCGACGGGGCCGCGCGGGCGTGTGCGGGGACCCCTCGCTGCGCGCGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
V--L--W--Q--I--L--V--E--D--F--D--L--H--G--A--L--Q--D--D--A--L--A--L--L--T--D--G--L-----W--G--R--A--D
TGCTCTGGCAGATCCTGGTGGAGGACTTCGACCTGCACGGGGCGCTGCAGGACGACGCGCTGGCTCTGCTCACCGACGGGCTG---TGGGGCCGCGCCGA
                                                  ::.:::::::::::::::::: : ::.:: :::     :: .::::::::
--------------------------------------------------GATGACGCGCTGGCTCTGCTCCC-GATGGCCTGT--GCGGTTCGCGCCGA
---------------------------------------------------D--D--A--L--A--L--L--T--D--G--L--\--W--V--R--A--D

----------------------------------------------------------------------------------------------------
--L--A--P--A--L--R--G--L--A--R--A--F--E--L--L--E--L--A--A--V--H--L--Y--L--L--P--W--R--K--E--F--T--T-
CCTGGCGCCCGCGCTACGCGGCCTGGCTCGCGCCTTCGAGCTTCTGGAGCTCGCCGCGGTGCACCTGTACCTGCTGCCCTGGAGGAAGGAGTTCACCACC
:::::: ::::: ::.:::::::: ::.: : .::::::::: :::::::: ::::: :::::::::::.::::::::::::::.::::::::.::::::
CCTGGCCCCCGCCCTGCGCGGCCTTGCCCCCTTCTTCGAGCTGCTGGAGCTGGCCGCCGTGCACCTGTATCTGCTGCCCTGGAGAAAGGAGTTTACCACC
--L--A--P--A--L--R--G--L--A--P--F--F--E--L--L--E--L--A--A--V--H--L--Y--L--L--P--W--R--K--E--F--T--T-

--------><------------------------------------------------------------------------------------------
-I--K--T--F--S--G--G--Y--V--H--V--L--K--G--V--L--S--D--D--L--L--L--K--S--F--Q--K--M--G--Y--V--R--R--
ATCAAGACCTTCTCTGGGGGCTACGTGCACGTGCTGAAGGGTGTGCTCTCAGACGACCTCCTCCTGAAGAGCTTCCAGAAGATGGGCTACGTACGCAGAG
::::::                                                                                              
ATCAAG----------------------------------------------------------------------------------------------
-I--K-----------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
D--S--H--R--L--M--V--T--A--L--P--P--A--C--Q--L--V--Q--V--A--L--G--C--F--A--L--R--L--E--C--E--I--L--G
ACAGCCATCGGCTCATGGTGACCGCCCTGCCCCCCGCCTGCCAGCTGGTGCAGGTGGCCCTGGGCTGCTTCGCCCTCCGGCTGGAGTGTGAGATCCTGGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--E--V--L--A--Q--L--G--T--S--V--L--P--A--E--E--L--L--Q--A--R--R--A--S--G--D--V--A--S--C--V--A--W--L-
TGAGGTGCTGGCCCAGCTGGGCACCAGTGTGCTGCCAGCTGAGGAGCTGCTGCAGGCACGGCGTGCCAGCGGGGACGTGGCCTCCTGTGTGGCCTGGCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-Q--Q--R--L--A--Q--D--E--E--P--P--P--L--P--P--R--G--S--P--A--A--Y--R--A--P--L--D--L--Y--R--D--L--Q--
CAGCAGCGGCTGGCCCAGGATGAGGAGCCGCCACCCCTGCCCCCCCGAGGCTCCCCTGCTGCTTACAGGGCCCCACTGGACTTATACCGGGACTTGCAGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
E--D--E--G--S--E--D--A--S--L--Y--G--E--P--S--P--G--P--D--S--P--P--A--E--L--A--Y--R--P--P--L--W--E--Q
AAGACGAGGGGTCGGAGGACGCCAGCCTGTATGGGGAGCCGTCACCAGGCCCTGACTCGCCCCCGGCGGAGCTGGCCTACAGGCCACCACTCTGGGAGCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--S--A--K--L--W--G--T--G--G--R--A--W--E--P--P--A--E--E--L--P--Q--A--S--S--P--P--Y--G--A--L--E--E--G-
GAGTGCCAAACTGTGGGGCACTGGGGGCCGGGCCTGGGAGCCCCCAGCTGAGGAGCTGCCGCAGGCCAGCAGCCCACCATATGGGGCCTTGGAGGAGGGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-L--E--P--E--P--S--A--F--S--F--L--S--L--R--R--E--L--S--R--P--G--D--L--A--T--P--E--S--S--A--A--A--S--
CTGGAACCTGAACCTTCCGCCTTCTCCTTCCTCTCTCTGCGCCGTGAGCTGAGTAGGCCTGGGGACCTGGCCACCCCTGAAAGCTCTGCAGCGGCCAGCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
P--R--R--I--R--A--E--G--V--P--A--S--A--Y--R--S--V--S--E--P--P--G--Y--Q--A--H--S--C--L--S--P--G--A--L
CGAGGCGTATTCGGGCAGAGGGGGTACCAGCCTCAGCCTATAGGTCTGTCTCGGAGCCCCCAGGCTACCAGGCACACAGCTGCCTGTCCCCTGGCGCCCT
                                                                                               :::::
-----------------------------------------------------------------------------------------------GCCCT
------------------------------------------------------------------------------------------------A--L

----------------------------------------------------------------------------------------------------
--P--T--L--C--C--D--T--C--R--Q--L--H--A--A--H--C--A--A--L--P--A--C--R--P--G--H--S--L--R--V--L--L--G-
GCCCACCCTCTGCTGCGACACCTGTCGCCAGCTGCATGCTGCCCACTGTGCAGCCCTGCCCGCCTGCCGTCCAGGCCACTCGCTGCGTGTGCTGCTTGGC
:::::::::::::::.:::::::::::::::::::..:::::::::::. : :::::::::::::::::.::::::::: .:::::..:: ::::  :: 
GCCCACCCTCTGCTGTGACACCTGTCGCCAGCTGCGCGCTGCCCACTGCCCCGCCCTGCCCGCCTGCCGCCCAGGCCACGTGCTGCACGTCCTGCGGGGG
--P--T--L--C--C--D--T--C--R--Q--L--R--A--A--H--C--P--A--L--P--A--C--R--P--G--H--V--L--H--V--L--R--G-

------------------------------------------------------------------------------
-D--A--Q--R--R--L--W--L--Q--R--A--Q--M--D--T--L--L--Y--N--S--P--G--A--R--P--*-
GACGCCCAGCGGCGCTTGTGGCTACAGCGTGCACAGATGGACACTCTGCTCTACAACAGCCCCGGGGCCCGGCCCTAG
.::. ::::::::::.:::::::.::: : ::::::.::::..:.:::::::::.: .::::.:::::::.::: :::
AACAGCCAGCGGCGCCTGTGGCTGCAGAGGGCACAGGTGGATGCCCTGCTCTACGAAGGCCCTGGGGCCCAGCCGTAG
-N--S--Q--R--R--L--W--L--Q--R--A--Q--V--D--A--L--L--Y--E--G--P--G--A--Q--P--*-

Pig Consensus Sequence

>BGISUST0000877715
----------------------------------------------------------------------------------------------------
--------------------------------------------------GATGACGCGCTGGCTCTGCTcgATGGCCTggCGGTTCGCGCCGACCTGGC
CCCCGCCCTGCGCGGCCTTGCCCCCTTCTTCGAGCTGCTGGAGCTGGCCGCCGTGCACCTGTATCTGCTGCCCTGGAGAAAGGAGTTTACCACCATCAAG
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
-----------------------------------------------------------------------------------------GCCCTGCCCAC
CCTCTGCTGTGACACCTGTCGCCAGCTGCGCGCTGCCCACTGCCCCGCCCTGCCCGCCTGCCGCCCAGGCCACGTGCTGCACGTCCTGCGGGGGAACAGC
CAGCGGCGCCTGTGGCTGCAGAGGGCACAGGTGGATGCCCTGCTCTACGAAGGCCCTGGGGCCCAGCCGTAG


>BGISUSP0000877715
--------------------------------------------------DDALALLDGLAVRADLAPALRGLAPFFELLELAAVHLYLLPWRKEFTTIK
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
---------------------------------------------------------------ALPTLCCDTCRQLRAAHCPALPACRPGHVLHVLRGNS
QRRLWLQRAQVDALLYEGPGAQP*