Sequences
EST Library Info
cad1Unavailable
isp1M. Infraspinatus
jej1Small intestine, jejunum
sin3Small intestine
spl1Spleen
thg4Thyroid gland
tra1Trachea
Clusters
Oligos
SNPs

Gene ID ENSG00000160654 (click for geneview)
Transcript ID ENST00000292144(link to ensembl)
Symbol CD3G
Localtion Chromosome:11:117720311:117729261:1 band: 11q23.3
Description T-cell surface glycoprotein CD3 gamma chain precursor (T-cell receptor T3 gamma chain). [Source:Uniprot/SWISSPROT;Acc:P09693]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-----------------------------------------------------><----------------------><--------------------
-M--E--Q--G--K--G--L--A--V--L--I--L--A--I--I--L--L--Q--G--T--L--A--Q--S--I--K--G--N--H--L--V--K--V--
ATGGAACAGGGGAAGGGCCTGGCTGTCCTCATCCTGGCTATCATTCTTCTTCAAGGTACTTTGGCCCAGTCAATCAAAGGAAACCACTTGGTTAAGGTGT
:::::.:::::.::: ..::::::: :::::::::::::::.:.::::::::::                                              
ATGGAGCAGGGAAAGCATCTGGCTGGCCTCATCCTGGCTATTACTCTTCTTCAA----------------------------------------------
-M--E--Q--G--K--H--L--A--G--L--I--L--A--I--T--L--L--Q-----------------------------------------------

----------------------------------------------------------------------------------------------------
Y--D--Y--Q--E--D--G--S--V--L--L--T--C--D--A--E--A--K--N--I--T--W--F--K--D--G--K--M--I--G--F--L--T--E
ATGACTATCAAGAAGATGGTTCGGTACTTCTGACTTGTGATGCAGAAGCCAAAAATATCACATGGTTTAAAGATGGGAAGATGATCGGCTTCCTAACTGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--D--K--K--K--W--N--L--G--S--N--A--K--D--P--R--G--M--Y--Q--C--K--G--S--Q--N--K--S--K--P--L--Q--V--Y-
AGATAAAAAAAAATGGAATCTGGGAAGTAATGCCAAGGACCCTCGAGGGATGTATCAGTGTAAAGGATCACAGAACAAGTCAAAACCACTCCAAGTGTAT
                                  ::::::::::::::::: :::..::::.:::::::: ::.: :: ::::::: :::::::::.:::
----------------------------------AAGGACCCTCGAGGGATCTATTGGTGTGAAGGATCAAAGGAGAATTCAAAACGACTCCAAGTATAT
-----------------------------------K--D--P--R--G--I--Y--W--C--E--G--S--K--E--N--S--K--R--L--Q--V--Y-

------><--------------------------------------------------------------------------------------------
-Y--R--M--C--Q--N--C--I--E--L--N--A--A--T--I--S--G--F--L--F--A--E--I--V--S--I--F--V--L--A--V--G--V--
TACAGAATGTGTCAGAACTGCATTGAACTAAATGCAGCCACCATATCTGGCTTTCTCTTTGCTGAAATCGTCAGCATTTTCGTCCTTGCTGTTGGGGTCT
::.:::   :::::::::::::::::.::.::: :::::::..:.:::::.::: :::: .::::::::.::::: ::::. ::::::::::::::::::
TATAGA---TGTCAGAACTGCATTGAGCTGAATTCAGCCACTGTGTCTGGTTTTATCTTGACTGAAATCATCAGCCTTTTTTTCCTTGCTGTTGGGGTCT
-Y--R-----C--Q--N--C--I--E--L--N--S--A--T--V--S--G--F--I--L--T--E--I--I--S--L--F--F--L--A--V--G--V--

--------------------------------------><------------------------------------------><----------------
Y--F--I--A--G--Q--D--G--V--R--Q--S--R--A--S--D--K--Q--T--L--L--P--N--D--Q--L--Y--Q--P--L--K--D--R--E
ACTTCATTGCTGGACAGGATGGAGTTCGCCAGTCGAGAGCTTCAGACAAGCAGACTCTGTTGCCCAATGACCAGCTCTACCAGCCCCTCAAGGATCGAGA
::::::::::.:::::::::::::::::::::::.:::                                             :::::.::::::::.::
ACTTCATTGCCGGACAGGATGGAGTTCGCCAGTCAAGA---------------------------------------------CCCCTTAAGGATCGGGA
Y--F--I--A--G--Q--D--G--V--R--Q--S--R-----------------------------------------------P--L--K--D--R--E

------------------------------------------------>
--D--D--Q--Y--S--H--L--Q--G--N--Q--L--R--R--N--*-
AGATGACCAGTACAGCCACCTTCAAGGAAACCAGTTGAGGAGGAATTGA
:::::::::.::.:::::::::::::::::: : :..::::.:::::::
AGATGACCAATATAGCCACCTTCAAGGAAACAATTCAAGGAAGAATTGA
--D--D--Q--Y--S--H--L--Q--G--N--N--S--R--K--N--*-

Pig Consensus Sequence

>BGISUST0000878900
ATGGAGCAGGGAAAGCATCTGGCTGGCCTCATCCTGGCTATTACTCTTCTTCAA----------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------AAGGACCCTCGAGGGATCTATTGGTGTGAAGGATCAAAGGAGAATTCAAAACGACTCCAAGTATAT
TATAGA---TGTCAGAACTGCATTGAGCTGAATTCAGCCACTGTGTCTGGTTTTATCTTGACTGAAATCATCAGCCTTTTTTTCCTTGCTGTTGGGGTCT
ACTTCATTGCCGGACAGGATGGAGTTCGCCAGTCAAGA---------------------------------------------CCCCTTAAGGATCGGGA
AGATGACCAATATAGCCACCTTCAAGGAAACAATTCAAGGAAGAATTGA


>BGISUSP0000878900
MEQGKHLAGLILAITLLQ------------------------------------------------------------KDPRGIYWCEGSKENSKRLQVY
YR-CQNCIELNSATVSGFILTEIISLFFLAVGVYFIAGQDGVRQSR---------------PLKDREDDQYSHLQGNNSRKN*