Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000162644 (click for geneview)
Transcript ID ENST00000294662(link to ensembl)
Symbol XP_208234.1
Localtion Chromosome:1:89281989:89282471:-1 band: 1p22.2
Description PREDICTED: similar to unactive progesterone receptor, 23 kD; likely ortholog of mouse telomerase binding protein, p23
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--Q--P--A--S--A--K--W--Y--D--Q--R--H--Y--V--F--I--E--F--C--V--E--D--S--K--D--V--N--V--N--F--E--K--
ATGCAGCCTGCTTCTGCAAAGTGGTACGATCAAAGGCACTATGTCTTCATTGAATTTTGTGTTGAAGACAGTAAGGATGTTAATGTAAATTTTGAAAAAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
S--K--L--T--F--S--C--L--G--G--S--D--N--F--K--H--L--N--E--I--D--L--F--H--C--I--D--T--N--D--S--K--H--K
CCAAACTTACATTCAGTTGTCTCGGAGGAAGTGATAATTTTAAGCATTTAAATGAAATTGATCTTTTTCACTGTATTGATACAAACGATTCCAAGCATAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--R--T--D--R--S--I--L--C--C--L--R--K--G--E--S--G--Q--S--W--P--R--L--T--K--E--R--A--K--L--N--W--L--S-
AAGAACGGACAGATCAATTTTATGTTGTTTACGAAAAGGAGAATCTGGACAGTCATGGCCAAGGTTAACAAAAGAAAGGGCAAAGCTTAATTGGCTTAGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-V--D--F--N--N--W--K--D--W--E--D--D--S--D--E--D--M--S--N--F--D--R--F--S--E--M--M--N--N--M--G--G--D--
GTTGACTTCAATAATTGGAAAGACTGGGAAGATGATTCAGATGAAGACATGTCTAATTTTGATCGTTTCTCTGAGATGATGAATAACATGGGTGGTGATG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------------------------------------->
E--D--V--D--L--P--E--V--D--G--A--D--D--D--S--Q--D--S--D--D--E--K--M--P--D--L--Q--*-
AGGATGTAGATTTACCAGAAGTAGATGGAGCAGATGATGATTCACAAGACAGTGATGATGAAAAAATGCCAGATCTGCAGTAA
                                                                                   
-----------------------------------------------------------------------------------
-----------------------------------------------------------------------------------