Sequences
EST Library Info
lin1Large intestine
tra1Trachea
Clusters
Oligos
SNPs

Gene ID ENSG00000162645 (click for geneview)
Transcript ID ENST00000294671(link to ensembl)
Symbol NP_997281.1
Localtion Chromosome:1:89309455:89353744:-1 band: 1p22.2
Description guanylate binding protein 4-like
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--A--S--E--I--H--M--P--G--P--V--C--L--T--E--N--T--K--G--H--L--V--V--N--S--E--A--L--E--I--L--S--A--
ATGGCATCAGAGATCCACATGCCAGGCCCAGTGTGCCTCACTGAGAACACTAAAGGGCATCTGGTGGTGAATTCAGAAGCTCTGGAAATCCTGTCTGCCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------------------------------------------------><---------
I--T--Q--P--V--V--V--V--A--I--V--G--L--Y--R--T--G--K--S--Y--L--M--N--K--L--A--G--K--N--K--G--F--P--L
TTACACAGCCTGTAGTAGTGGTGGCAATTGTGGGCCTCTACCGCACAGGCAAATCCTACCTAATGAACAAGCTGGCTGGGAAGAACAAAGGCTTCCCTCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--G--C--T--V--K--S--E--T--K--G--I--W--M--W--C--V--P--H--P--S--K--P--N--H--T--L--I--L--L--D--T--E--G-
GGGCTGCACAGTGAAGTCTGAAACCAAAGGCATCTGGATGTGGTGTGTGCCCCACCCCTCCAAGCCAAACCACACCCTGATCCTTCTGGACACGGAGGGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------><---------------------------------------------------------------------------------
-L--G--D--M--E--K--S--D--P--K--S--D--S--W--I--F--A--L--A--V--L--L--S--S--S--F--V--Y--N--S--M--G--T--
CTGGGTGATATGGAAAAGAGTGACCCTAAGAGTGACTCGTGGATCTTTGCCCTGGCTGTGCTTCTAAGCAGCAGCTTTGTCTACAACAGCATGGGCACCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------><-----------------------------------------------------------------------
I--N--H--Q--A--L--E--Q--L--H--Y--V--T--E--L--T--E--L--I--R--A--K--S--C--P--R--P--D--E--V--E--D--S--S
TCAACCACCAGGCCCTGGAGCAGCTGCACTACGTGACTGAGCTAACAGAGCTAATCAGGGCAAAATCGTGCCCCAGACCTGATGAAGTTGAGGACTCCAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--E--F--V--S--F--F--P--D--F--I--W--T--V--R--D--F--T--L--E--L--K--L--D--G--H--P--I--T--E--D--E--Y--L-
CGAGTTTGTGAGTTTCTTTCCAGACTTTATTTGGACTGTTCGAGATTTTACCCTGGAGCTGAAGTTAGATGGACACCCCATCACAGAAGATGAGTACCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------><--------------------------------------------------------------------------
-E--N--A--L--K--L--I--S--G--K--N--P--Q--I--Q--N--S--N--K--P--R--E--W--I--R--H--F--F--P--K--Q--K--C--
GAGAATGCCTTGAAGCTGATTTCAGGCAAGAATCCCCAAATCCAAAATTCTAACAAGCCCAGGGAGTGGATCAGGCATTTCTTTCCAAAACAGAAGTGCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
F--V--F--D--R--P--I--N--D--K--K--L--L--L--H--V--E--E--V--R--E--D--Q--L--D--S--N--F--Q--M--Q--S--E--N
TTGTCTTTGACCGGCCAATAAATGACAAAAAACTCTTACTCCATGTTGAAGAAGTACGAGAAGACCAACTGGATAGTAATTTCCAGATGCAATCAGAAAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------><----------------------------
--F--C--S--Y--I--F--T--H--A--K--T--K--T--L--R--E--G--I--L--V--T--G--N--R--L--G--M--L--V--E--T--Y--L-
TTTCTGTTCTTATATCTTCACCCATGCAAAGACCAAGACCCTGAGAGAGGGAATCCTTGTCACTGGAAACCGGCTGGGGATGCTGGTGGAGACCTACCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-D--A--I--N--S--G--A--T--P--C--L--E--N--A--M--A--V--L--A--Q--C--E--N--S--A--A--V--Q--R--A--A--N--H--
GATGCCATCAACAGTGGAGCGACTCCTTGTCTGGAGAATGCAATGGCAGTTCTGGCCCAGTGTGAGAACTCAGCAGCCGTGCAGAGGGCAGCCAACCACT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
Y--S--Q--Q--M--A--Q--Q--V--R--F--P--T--D--T--L--Q--E--L--L--D--V--H--A--V--C--E--R--E--A--I--A--V--F
ACAGCCAGCAGATGGCCCAGCAAGTGAGATTCCCCACAGACACACTCCAGGAGCTGCTGGACGTGCATGCAGTTTGTGAGAGGGAAGCCATTGCAGTCTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------><-----------------------------------------------
--M--E--Y--S--F--K--D--K--S--Q--E--F--Q--K--K--L--V--D--T--M--E--K--K--K--E--D--F--V--L--Q--N--E--E-
CATGGAGTACTCCTTCAAAGATAAAAGCCAGGAATTTCAGAAGAAGCTTGTGGACACCATGGAGAAAAAGAAGGAAGACTTTGTGCTGCAGAATGAAGAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-A--S--A--K--Y--C--Q--A--E--L--K--R--L--S--E--L--L--T--E--S--I--S--R--G--T--F--F--V--P--G--G--H--N--
GCATCTGCCAAATATTGTCAGGCTGAGCTTAAGCGGCTTTCAGAGCTCTTGACAGAAAGTATTTCAAGAGGAACTTTCTTTGTTCCGGGGGGGCACAATA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------><----------------------------------
I--Y--L--E--A--K--K--K--I--E--Q--D--Y--T--L--V--P--R--K--G--V--K--A--D--E--V--L--Q--S--F--L--Q--S--Q
TCTACTTAGAAGCAAAAAAGAAGATTGAACAGGACTATACACTAGTGCCCAGAAAAGGAGTTAAGGCAGACGAGGTCCTCCAGAGCTTCCTGCAGTCACA
                                                                 :::. :::::::::::::::::::::.:.:::.::
-----------------------------------------------------------------GCAACCGAGGTCCTCCAGAGCTTCCTACGGTCGCA
------------------------------------------------------------------A--T--E--V--L--Q--S--F--L--R--S--Q

-------------------------------------------------------------------><-------------------------------
--V--V--I--E--E--S--I--L--Q--S--D--K--A--L--T--A--G--E--K--A--I--A--A--K--Q--A--K--K--E--A--A--E--K-
GGTGGTTATAGAGGAATCCATCCTGCAGTCAGACAAAGCCCTCACTGCTGGAGAGAAGGCCATAGCAGCTAAGCAGGCTAAGAAGGAGGCAGCTGAAAAG
:: .:  :.::::: . ::::::::::: :::::::::::::::::: :::::: ::::::::::::                                 
GGAAGAAACAGAGGTGGCCATCCTGCAGGCAGACAAAGCCCTCACTGATGGAGACAAGGCCATAGCA---------------------------------
--E--E--T--E--V--A--I--L--Q--A--D--K--A--L--T--D--G--D--K--A--I--A----------------------------------

----------------------------------------------------------------------------------------------------
-E--Q--E--L--L--R--Q--K--Q--K--E--Q--Q--Q--M--M--E--A--Q--E--R--S--F--Q--E--N--I--A--Q--L--K--K--K--
GAACAGGAGCTGCTAAGACAAAAACAGAAGGAACAGCAGCAAATGATGGAGGCTCAAGAGAGAAGTTTCCAGGAAAACATAGCTCAACTCAAGAAGAAGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------><-------------------------------------
M--E--R--E--R--E--N--Y--M--R--E--L--R--K--M--L--S--H--K--M--K--V--L--E--E--L--L--T--E--G--F--K--E--I
TGGAGAGGGAAAGGGAAAACTATATGAGAGAACTGAGAAAGATGTTGAGTCACAAGATGAAGGTCCTAGAAGAACTGCTTACTGAAGGATTTAAAGAGAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--F--E--S--L--N--E--E--I--N--R--L--K--E--Q--I--E--A--A--E--N--E--E--P--S--V--F--S--Q--I--L--D--V--A-
ATTTGAGTCGTTAAATGAAGAGATTAATCGACTGAAAGAACAAATTGAAGCAGCTGAAAATGAAGAGCCCTCAGTGTTTTCACAGATTCTTGATGTGGCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-G--S--I--F--I--A--A--L--P--G--A--A--K--L--V--D--L--G--M--K--I--L--S--S--L--C--N--R--L--R--N--P--G--
GGCAGTATATTTATTGCAGCACTACCTGGGGCTGCTAAGCTAGTTGATTTAGGAATGAAAATTCTTAGCTCATTATGTAATAGGCTGAGAAATCCTGGTA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------->
K--K--I--I--S--*-
AGAAAATTATAAGCTGA
                 
-----------------
-----------------

Pig Consensus Sequence

>BGISUST0000882387
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
-----------------------------------------------------------------GCAACCGAGGTCCTCCAGAGCTTCCTACGGTCGCA
GGAAGAAACAGAGGTGGCCATCCTGCAGGCAGACAAAGCCCTCACTGATGGAGACAAGGCCATAGCA---------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
-----------------


>BGISUSP0000882387
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
-------------------------------------------------------ATEVLQSFLRSQEETEVAILQADKALTDGDKAIA-----------
----------------------------------------------------------------------------------------------------
---------------------------------------