Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000163046 (click for geneview)
Transcript ID ENST00000295181(link to ensembl)
Symbol NP_001019826.1
Localtion Chromosome:2:132739216:132753260:-1 band: 2q21.2
Description Hypothetical protein.
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--E--R--L--S--A--A--P--V--K--G--Q--T--G--P--E--R--P--S--P--F--S--Q--L--V--Y--T--N--N--D--S--Y--V--
ATGGAGAGGCTCTCTGCCGCCCCTGTCAAGGGCCAGACGGGCCCAGAGCGCCCGAGCCCCTTCAGTCAGCTGGTCTACACCAACAACGACTCTTACGTGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
I--H--H--G--D--L--R--K--I--H--K--A--A--S--R--G--Q--A--W--K--L--E--R--M--M--K--K--T--T--M--D--L--N--I
TTCACCATGGGGATCTCAGGAAGATCCACAAAGCTGCCTCCCGGGGCCAAGCCTGGAAGCTGGAGAGGATGATGAAGAAGACGACAATGGACCTGAACAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------><---------------------------------------------------------------------------------
--R--D--A--K--K--R--T--A--L--Y--W--A--C--A--N--G--H--A--E--V--V--T--L--L--V--D--R--K--C--Q--L--D--V-
AAGAGATGCGAAGAAGAGGACTGCTCTATACTGGGCCTGTGCCAATGGCCATGCAGAAGTAGTAACACTTCTGGTAGATAGAAAGTGTCAGCTTGACGTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------><------------------------------------------------------------------
-L--D--G--E--N--R--T--I--L--M--K--A--L--Q--C--Q--R--E--A--C--A--N--I--L--I--D--S--G--A--D--P--N--I--
CTTGATGGTGAAAACAGGACCATTCTGATGAAGGCTCTGCAATGCCAGAGGGAGGCTTGTGCAAATATTCTCATAGATTCTGGTGCTGATCCAAATATTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
V--D--V--Y--G--N--T--A--V--H--Y--A--V--N--S--E--N--L--S--V--V--A--K--L--L--S--C--G--A--D--I--E--V--K
TAGATGTGTATGGCAACACAGCTGTCCATTATGCTGTTAACAGTGAGAATTTGTCAGTGGTGGCAAAATTGCTGTCCTGTGGTGCAGACATCGAAGTGAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------><--------------------------------------------------------------------------------------------
--N--K--A--G--H--T--P--L--L--L--A--I--R--K--R--S--E--E--I--V--E--F--L--L--T--K--N--A--N--A--N--A--V-
GAACAAGGCTGGCCACACACCACTTTTACTGGCCATAAGGAAAAGAAGTGAGGAAATTGTGGAATTTTTACTGACAAAAAATGCAAATGCAAATGCAGTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------><-------------------------------------------------------------------------------------
-D--K--F--K--C--T--A--L--M--L--A--I--C--H--G--S--S--E--I--V--G--K--L--L--Q--Q--N--V--D--I--C--A--E--
GATAAGTTTAAATGCACAGCCCTCATGCTTGCCATATGTCATGGATCATCAGAGATAGTTGGCAAGCTTCTTCAGCAAAATGTTGACATCTGTGCTGAAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------->
A--T--C--G--M--I--A--E--R--Y--A--V--A--C--G--F--N--L--*-
CTACATGTGGAATGATTGCAGAACGTTATGCTGTTGCTTGTGGATTTAATCTCTAA
                                                        
--------------------------------------------------------
--------------------------------------------------------