Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000163214 (click for geneview)
Transcript ID ENST00000295373(link to ensembl)
Symbol DHX57
Localtion Chromosome:2:38936529:39014672:-1 band: 2p22.1
Description DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57 isoform 1 [Source:RefSeq_peptide;Acc:NP_945314]
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--S--S--S--V--R--R--K--G--K--P--G--K--G--G--G--K--G--S--S--R--G--G--R--G--G--R--S--H--A--S--K--S--
ATGAGTTCTTCAGTAAGAAGAAAAGGCAAGCCAGGCAAAGGAGGTGGAAAAGGGTCTTCTAGAGGAGGAAGAGGAGGCAGGAGTCACGCCAGTAAATCTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
H--G--S--G--G--G--G--G--G--G--G--G--G--G--G--G--N--R--K--A--S--S--R--I--W--D--D--G--D--D--F--C--I--F
ATGGGAGTGGTGGCGGTGGCGGTGGTGGTGGTGGTGGAGGTGGCGGCAACAGAAAGGCCTCCAGTAGAATATGGGATGATGGAGATGACTTTTGTATCTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------><---------------------------------------------------------------------------
--S--E--S--R--R--P--S--R--P--S--N--S--N--I--S--K--G--E--S--R--P--K--W--K--P--K--A--K--V--P--L--Q--T-
CAGTGAATCAAGGCGCCCTTCCAGACCTAGCAACAGTAACATAAGCAAAGGAGAGTCACGCCCAAAATGGAAACCCAAAGCCAAAGTACCCCTTCAGACT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------><----------------
-L--H--M--T--S--E--N--Q--E--K--V--K--A--L--L--R--D--L--Q--E--Q--D--A--D--A--G--S--E--R--G--L--S--G--
CTACATATGACTTCTGAGAATCAAGAGAAAGTGAAAGCTCTTCTCCGAGACCTGCAAGAACAAGATGCTGATGCTGGATCTGAAAGAGGCCTTTCTGGGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
E--E--E--D--D--E--P--D--C--C--N--D--E--R--Y--W--P--A--G--Q--E--P--S--L--V--P--D--L--D--P--L--E--Y--A
AGGAGGAAGATGATGAGCCTGATTGCTGTAACGATGAGCGGTACTGGCCAGCTGGACAGGAACCTTCCCTCGTTCCCGACTTGGATCCTTTGGAATATGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------------------------------><---------------------------
--G--L--A--S--V--E--P--Y--V--P--E--F--T--V--S--P--F--A--V--Q--K--L--S--R--Y--G--F--N--T--E--R--C--Q-
TGGCTTAGCCTCAGTGGAGCCTTATGTTCCAGAATTTACAGTCTCCCCATTTGCAGTGCAAAAACTTTCCAGGTATGGTTTCAATACTGAACGCTGTCAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-A--V--L--R--M--C--D--G--D--V--G--A--S--L--E--H--L--L--T--Q--C--F--S--E--T--F--G--E--R--M--K--I--S--
GCGGTCCTGAGGATGTGTGATGGAGATGTGGGAGCATCACTAGAGCATCTCCTTACCCAGTGTTTTTCAGAGACATTTGGAGAGAGGATGAAGATCTCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
E--A--V--N--Q--I--S--L--D--E--C--M--E--Q--R--Q--E--E--A--F--A--L--K--S--I--C--G--E--K--F--I--E--R--I
AGGCAGTCAACCAGATAAGCTTGGATGAGTGTATGGAACAGCGACAGGAAGAGGCATTTGCTCTCAAGTCCATCTGTGGAGAAAAATTTATAGAAAGAAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--Q--N--R--V--W--T--I--G--L--E--L--E--Y--L--T--S--R--F--R--K--S--K--P--K--E--S--T--K--N--V--Q--E--N-
TCAGAACAGAGTCTGGACCATTGGGTTAGAACTGGAGTATCTGACAAGTAGATTCCGCAAATCCAAGCCAAAAGAAAGTACCAAAAATGTACAAGAGAAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-S--L--E--I--C--K--F--Y--L--K--G--N--C--K--F--G--S--K--C--R--F--K--H--E--V--P--P--N--Q--I--V--G--R--
TCACTTGAAATCTGTAAATTTTACCTCAAAGGAAATTGTAAATTTGGATCAAAATGCAGATTCAAACATGAAGTGCCCCCAAATCAAATTGTTGGAAGAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
I--E--R--S--V--D--D--S--H--L--N--A--I--E--D--A--S--F--L--Y--E--L--E--I--R--F--S--K--D--H--K--Y--P--Y
TAGAAAGAAGTGTAGATGATTCTCATCTTAATGCTATTGAAGATGCATCTTTTTTATATGAACTTGAAATTCGATTTTCTAAAGACCACAAATATCCCTA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--Q--A--P--L--V--A--F--Y--S--T--N--E--N--L--P--L--A--C--R--L--H--I--S--E--F--L--Y--D--K--A--L--T--F-
CCAAGCTCCGCTCGTGGCATTTTATTCCACCAATGAGAACCTACCTCTGGCTTGTCGTTTACATATTTCTGAGTTTCTTTATGACAAGGCCTTGACATTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-A--E--T--S--E--P--V--V--Y--S--L--I--T--L--L--E--E--E--S--E--I--V--K--L--L--T--N--T--H--H--K--Y--S--
GCGGAAACTTCGGAACCTGTCGTATATTCTTTGATAACCCTTTTAGAGGAAGAGTCGGAAATAGTCAAGTTACTAACGAATACCCACCACAAGTATAGTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
D--P--P--V--N--F--L--P--V--P--S--R--T--R--I--N--N--P--A--C--H--K--T--V--I--P--N--N--S--F--V--S--N--Q
ACCCTCCTGTGAACTTTCTGCCAGTACCCTCTAGGACCAGAATAAATAATCCTGCCTGTCATAAAACAGTGATTCCAAATAATTCTTTTGTTTCTAATCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------><----------------------------------------------------------------------------------------
--I--P--E--V--E--K--A--S--E--S--E--E--S--D--E--D--D--G--P--A--P--V--I--V--E--N--E--S--Y--V--N--L--K-
AATTCCAGAAGTTGAAAAAGCATCAGAATCTGAGGAGTCAGATGAGGATGACGGTCCTGCACCTGTTATAGTAGAGAATGAAAGCTATGTGAACCTTAAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------------------><------------
-K--K--I--S--K--R--Y--D--W--Q--A--K--S--V--H--A--E--N--G--K--I--C--K--Q--F--R--M--K--Q--A--S--R--Q--
AAAAAGATTTCCAAAAGATATGACTGGCAGGCAAAGTCAGTACATGCTGAAAATGGTAAAATCTGCAAGCAGTTCCGAATGAAACAGGCTTCCAGACAGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
F--Q--S--I--L--Q--E--R--Q--S--L--P--A--W--E--E--R--E--T--I--L--N--L--L--R--K--H--Q--V--V--V--I--S--G
TCCAGTCCATTCTGCAAGAGAGGCAATCACTCCCTGCTTGGGAAGAAAGAGAAACCATTCTTAACTTATTGCGTAAGCACCAGGTGGTTGTCATAAGTGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------><------------------------------------------------------------------------------------------
--M--T--G--C--G--K--T--T--Q--I--P--Q--F--I--L--D--D--S--L--N--G--P--P--E--K--V--A--N--I--I--C--T--Q-
TATGACTGGATGTGGGAAAACCACACAAATTCCGCAGTTTATTCTGGATGATTCTCTGAATGGACCACCTGAGAAGGTAGCCAACATCATCTGTACCCAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-P--R--R--I--S--A--I--S--V--A--E--R--V--A--K--E--R--A--E--R--V--G--L--T--V--G--Y--Q--I--R--L--E--S--
CCCCGACGAATCTCTGCAATCTCTGTTGCTGAACGCGTTGCTAAAGAAAGAGCAGAGAGGGTGGGTCTGACCGTGGGATACCAGATTCGGTTAGAAAGTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----><----------------------------------------------------------------------------------------------
V--K--S--S--A--T--R--L--L--Y--C--T--T--G--V--L--L--R--R--L--E--G--D--T--A--L--Q--G--V--S--H--I--I--V
TCAAGTCCTCAGCCACCAGACTGTTATACTGCACCACGGGAGTGCTGCTGAGAAGGCTAGAAGGAGATACAGCTCTACAAGGAGTTTCCCATATCATTGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------><---------------------------------------------------------------------
--D--E--V--H--E--R--T--E--E--S--D--F--L--L--L--V--L--K--D--I--V--S--Q--R--P--G--L--Q--V--I--L--M--S-
TGATGAAGTTCATGAGAGGACAGAAGAAAGTGACTTCTTGCTGCTAGTTTTGAAGGACATTGTATCGCAGAGGCCAGGTCTTCAAGTTATTTTAATGAGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------------------><-----------------------------------
-A--T--L--N--A--E--L--F--S--D--Y--F--N--S--C--P--V--I--T--I--P--G--R--T--F--P--V--D--Q--F--F--L--E--
GCAACTCTAAACGCTGAGCTTTTTTCAGACTATTTTAATTCCTGCCCCGTTATTACTATACCAGGTCGTACATTTCCTGTTGATCAATTTTTTTTGGAAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------><--------------------------------------------------------------------------------
D--A--I--A--V--T--R--Y--V--L--Q--D--G--S--P--Y--M--R--S--M--K--Q--I--S--K--E--K--L--K--A--R--R--N--R
ATGCAATTGCTGTGACAAGGTATGTATTACAGGATGGGAGCCCATATATGCGGTCCATGAAACAGATTTCAAAGGAAAAGCTTAAAGCAAGGCGGAACAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--T--A--F--E--E--V--E--E--D--L--R--L--S--L--H--L--Q--D--Q--D--S--V--K--D--A--V--P--D--Q--Q--L--D--F-
AACTGCATTTGAAGAAGTGGAAGAAGACCTAAGGCTCTCCCTTCACCTCCAGGATCAGGATTCTGTCAAAGATGCAGTGCCAGATCAACAGTTAGATTTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------><--------------------------------------------------------------------------
-K--Q--L--L--A--R--Y--K--G--V--S--K--S--V--I--K--T--M--S--I--M--D--F--E--K--V--N--L--E--L--I--E--A--
AAGCAGCTCCTGGCCCGCTATAAAGGGGTTAGCAAGTCAGTCATCAAAACAATGTCCATCATGGATTTTGAAAAGGTGAATCTTGAATTAATAGAGGCCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------><---------------------------------------------------------
L--L--E--W--I--V--D--G--K--H--S--Y--P--P--G--A--I--L--V--F--L--P--G--L--A--E--I--K--M--L--Y--E--Q--L
TATTAGAGTGGATTGTGGATGGAAAGCACTCCTACCCTCCAGGTGCTATACTTGTATTTTTACCAGGACTAGCAGAAATCAAAATGCTTTATGAACAGCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------><------------------------------------------------------------
--Q--S--N--S--L--F--N--N--R--R--S--N--R--C--V--I--H--P--L--H--S--S--L--S--S--E--E--Q--Q--A--V--F--V-
ACAGTCTAATTCTCTTTTCAACAACAGACGTAGTAATCGATGTGTTATTCACCCACTTCATTCATCTTTATCCAGTGAAGAGCAGCAGGCTGTGTTTGTA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-K--P--P--A--G--V--T--K--I--I--I--S--T--N--I--A--E--T--S--I--T--I--D--D--V--V--Y--V--I--D--S--G--K--
AAACCTCCTGCAGGAGTAACTAAGATTATAATTTCCACCAACATTGCTGAGACATCCATAACCATCGATGATGTTGTCTATGTTATCGATTCTGGGAAAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------><--------------------------------------------------------------------------------------
M--K--E--K--R--Y--D--A--S--K--G--M--E--S--L--E--D--T--F--V--S--Q--A--N--A--L--Q--R--K--G--R--A--G--R
TGAAAGAAAAGAGATATGATGCCAGCAAAGGGATGGAAAGTCTAGAGGACACCTTTGTATCTCAAGCTAATGCTCTACAAAGGAAAGGCCGAGCAGGCCG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--V--A--S--G--V--C--F--H--L--F--T--S--H--H--Y--N--H--Q--L--L--K--Q--Q--L--P--E--I--Q--R--V--P--L--E-
TGTTGCATCTGGGGTCTGCTTCCATTTATTCACTAGCCATCACTACAATCACCAGCTTTTAAAACAACAGCTACCAGAAATACAAAGAGTGCCATTGGAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------><-------------------------------------------------------------------------------------
-Q--L--C--L--R--I--K--I--L--E--M--F--S--A--H--N--L--Q--S--V--F--S--R--L--I--E--P--P--H--T--D--S--L--
CAGCTGTGTCTAAGAATTAAAATTTTAGAGATGTTTAGTGCTCATAATCTCCAGTCTGTGTTCTCTCGGCTCATTGAACCTCCACACACCGATTCTCTTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
R--A--S--K--I--R--L--R--D--L--G--A--L--T--P--D--E--R--L--T--P--L--G--Y--H--L--A--S--L--P--V--D--V--R
GTGCCTCAAAAATACGATTACGAGACTTAGGAGCATTAACTCCAGATGAAAGATTGACCCCTCTTGGGTATCATTTGGCCTCTCTGCCCGTGGATGTGAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------------------------------------><--------
--I--G--K--L--M--L--F--G--S--I--F--R--C--L--D--P--A--L--T--I--A--A--S--L--A--F--K--S--P--F--V--S--P-
AATTGGCAAACTAATGTTGTTTGGGTCTATCTTCCGCTGTTTGGATCCTGCTCTCACCATTGCTGCCAGTTTGGCTTTTAAGTCTCCGTTTGTATCTCCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------------------><------------
-W--D--K--K--E--E--A--N--Q--K--K--L--E--F--A--F--A--N--S--D--Y--L--A--L--L--Q--A--Y--K--G--W--Q--L--
TGGGATAAAAAAGAAGAAGCTAACCAGAAAAAGCTGGAATTTGCATTCGCAAACAGTGATTATCTGGCCCTTCTACAAGCGTATAAGGGATGGCAGCTAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------><----------------------------
S--T--K--E--G--V--R--A--S--Y--N--Y--C--R--Q--N--F--L--S--G--R--V--L--Q--E--M--A--S--L--K--R--Q--F--T
GTACAAAAGAAGGCGTGCGTGCAAGTTATAATTACTGCAGACAAAACTTCTTGTCTGGAAGAGTTCTGCAGGAAATGGCCAGCCTCAAACGACAATTCAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--E--L--L--S--D--I--G--F--A--R--E--G--L--R--A--R--E--I--E--K--R--A--Q--G--G--D--G--V--L--D--A--T--G-
GGAACTGTTATCGGATATAGGGTTTGCAAGGGAAGGGCTCAGAGCAAGGGAAATTGAGAAAAGGGCCCAAGGAGGAGATGGTGTCTTAGATGCCACAGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----><-------------------------------------------------------------------------><------------------
-E--E--A--N--S--N--A--E--N--P--K--L--I--S--A--M--L--C--A--A--L--Y--P--N--V--V--Q--V--K--S--P--E--G--
GAAGAGGCAAACTCAAATGCTGAGAACCCCAAGCTGATATCAGCAATGCTGTGTGCTGCTTTGTATCCAAATGTAGTGCAGGTGAAAAGCCCAGAAGGAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
K--F--Q--K--T--S--T--G--A--V--R--M--Q--P--K--S--A--E--L--K--F--V--T--K--N--D--G--Y--V--H--I--H--P--S
AATTTCAGAAGACCAGTACTGGAGCTGTCAGAATGCAACCAAAATCAGCTGAGTTGAAGTTTGTCACCAAGAACGATGGATATGTACACATTCACCCTTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------><-----------------------------------------------------------------------------------
--S--V--N--Y--Q--V--R--H--F--D--S--P--Y--L--L--Y--H--E--K--I--K--T--S--R--V--F--I--R--D--C--S--M--V-
ATCAGTGAACTATCAGGTGAGACACTTTGACAGCCCCTACCTGTTGTACCACGAGAAGATAAAAACTAGTCGAGTATTCATCCGAGACTGCAGCATGGTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-S--V--Y--P--L--V--L--F--G--G--G--Q--V--N--V--Q--L--Q--R--G--E--F--V--V--S--L--D--D--G--W--I--R--F--
TCTGTGTACCCGCTGGTCTTGTTTGGAGGAGGCCAAGTGAATGTGCAGCTTCAAAGAGGAGAGTTCGTTGTCTCCCTGGATGATGGTTGGATCCGTTTTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------><----------------------------------------------------------------------------------
V--A--A--S--H--Q--V--A--E--L--V--K--E--L--R--C--E--L--D--Q--L--L--Q--D--K--I--K--N--P--S--I--D--L--C
TAGCTGCTTCCCATCAGGTGGCTGAACTGGTAAAGGAGCTTCGTTGCGAACTTGATCAGCTTCTCCAGGATAAAATTAAAAACCCAAGCATTGATCTGTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------>
--T--C--P--R--G--S--R--I--I--S--T--I--V--K--L--V--T--T--Q--*-
TACGTGTCCTCGAGGATCCCGGATCATCAGCACAATTGTGAAACTTGTCACCACACAATAA
                                                             
-------------------------------------------------------------
-------------------------------------------------------------