Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000177664 (click for geneview)
Transcript ID ENST00000295941(link to ensembl)
Symbol DNAH12
Localtion Chromosome:3:57406975:57415583:-1 band: 3p14.3
Description Dynein heavy chain (Fragment). [Source:Uniprot/SPTREMBL;Acc:Q92864]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<----------------------------------------><---------------------------------------------------------
-W--T--S--E--T--Q--E--V--I--S--G--G--T--E--G--L--K--K--Y--Y--K--E--L--Q--N--Q--L--N--E--I--V--E--L--
TGGACATCTGAGACACAGGAAGTGATAAGTGGCGGGACGGAGGGATTAAAGAAGTATTATAAGGAACTTCAGAACCAACTGAATGAGATTGTAGAGCTGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------------------------------><
V--R--G--K--L--S--K--Q--T--R--T--T--L--G--A--L--V--T--I--D--V--H--A--R--D--V--V--M--D--M--I--K--M--G
TAAGAGGAAAGTTGTCTAAGCAGACCAGGACCACTCTGGGGGCTTTGGTTACTATTGATGTCCATGCTAGAGATGTGGTCATGGACATGATTAAAATGGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--V--S--H--D--T--D--F--L--W--L--A--Q--L--R--Y--Y--W--E--N--E--N--A--R--V--R--I--I--N--C--N--V--K--Y-
TGTCTCACATGATACAGATTTCCTGTGGCTTGCTCAGCTCCGATATTATTGGGAAAATGAGAATGCCCGAGTTCGTATCATTAATTGCAATGTAAAATAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------------------------------><---------------------------
-A--Y--E--Y--L--G--N--S--P--R--L--V--I--T--P--L--T--D--R--C--Y--R--T--L--I--G--A--F--Y--L--N--L--G--
GCTTATGAATATCTTGGTAACTCACCTCGACTTGTCATTACGCCTCTAACTGACAGGTGTTACAGAACATTGATAGGTGCTTTCTATTTAAACCTTGGAG
                                                                        ::::::::.:::::::::::::::::::
------------------------------------------------------------------------ATAGGTGCCTTCTATTTAAACCTTGGAG
-------------------------------------------------------------------------I--G--A--F--Y--L--N--L--G--

----------------------------------------------------------------------------------------------------
G--A--P--E--G--P--A--G--T--G--K--T--E--T--T--K--D--L--A--K--A--L--A--V--Q--C--V--V--F--N--C--S--D--G
GTGCTCCAGAGGGGCCAGCAGGCACAGGAAAAACCGAAACCACCAAGGACTTGGCTAAAGCTCTTGCTGTACAGTGTGTGGTGTTCAACTGTTCTGATGG
::::::::::.::::::::::::::.::::::::.:::::::::::::::::::::::::::::::::::::::::::::::.::.:::::::: :::::
GTGCTCCAGAAGGGCCAGCAGGCACGGGAAAAACTGAAACCACCAAGGACTTGGCTAAAGCTCTTGCTGTACAGTGTGTGGTATTTAACTGTTCAGATGG
G--A--P--E--G--P--A--G--T--G--K--T--E--T--T--K--D--L--A--K--A--L--A--V--Q--C--V--V--F--N--C--S--D--G

------------------------><------------------------------------------------------------->
--L--D--Y--L--A--M--G--K--F--F--K--G--L--A--S--S--G--A--W--A--C--F--D--E--F--N--R--I--E-
GCTAGATTATCTAGCAATGGGAAAGTTTTTTAAAGGACTGGCTTCTTCTGGTGCTTGGGCTTGCTTTGATGAATTCAATCGAATTGAG
:::::::::::::::::::::::::                                                               
GCTAGATTATCTAGCAATGGGAAAG---------------------------------------------------------------
--L--D--Y--L--A--M--G--K----------------------------------------------------------------

Pig Consensus Sequence

>BGISUST0000890691
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
------------------------------------------------------------------------ATAGGTGCCTTCTATTTAAACCTTGGAG
GTGCTCCAGAAGGGCCAGCAGGCACGGGAAAAACTGAAACCACCAAGGACTTGGCTAAAGCTCTTGCTGTACAGTGTGTGGTATTTAACTGTTCAGATGG
GCTAGATTATCTAGCAATGGGAAAG---------------------------------------------------------------


>BGISUSP0000890691
----------------------------------------------------------------------------------------------------
------------------------IGAFYLNLGGAPEGPAGTGKTETTKDLAKALAVQCVVFNCSDGLDYLAMGK---------------------