Sequences
EST Library Info
ton1Tip of tongue, mucosal membrane
Clusters
Oligos
SNPs

Gene ID ENSG00000164107 (click for geneview)
Transcript ID ENST00000296507(link to ensembl)
Symbol HAND2
Localtion Chromosome:4:174820850:174825324:-1 band: 4q34.1
Description Heart- and neural crest derivatives-expressed protein 2 (Deciduum, heart, autonomic nervous system and neural crest derivatives-expressed protein 2) (dHAND).
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--S--L--V--G--G--F--P--H--H--P--V--V--H--H--E--G--Y--P--F--A--A--A--A--A--A--A--A--A--A--A--A--S--
ATGAGTCTGGTAGGTGGTTTTCCCCACCACCCGGTGGTGCACCACGAGGGCTACCCGTTTGCCGCCGCCGCCGCCGCAGCTGCCGCCGCCGCCGCCAGCC
::::::::::: :: ::.::.::.::::::::::::::::::::.::::::::.:::::.::::: ::::: ::::: :: :::::::: ::::::::::
ATGAGTCTGGTTGGGGGCTTCCCTCACCACCCGGTGGTGCACCATGAGGGCTATCCGTTCGCCGCGGCCGCGGCCGCTGCGGCCGCCGCGGCCGCCAGCC
-M--S--L--V--G--G--F--P--H--H--P--V--V--H--H--E--G--Y--P--F--A--A--A--A--A--A--A--A--A--A--A--A--S--

----------------------------------------------------------------------------------------------------
R--C--S--H--E--E--N--P--Y--F--H--G--W--L--I--G--H--P--E--M--S--P--P--D--Y--S--M--A--L--S--Y--S--P--E
GCTGCAGCCATGAGGAGAACCCCTACTTCCATGGCTGGCTCATCGGCCACCCCGAGATGTCGCCCCCCGACTACAGCATGGCCCTGTCCTACAGCCCCGA
::::::::::.::::::::::::::::::::.::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::.:: ::
GCTGCAGCCACGAGGAGAACCCCTACTTCCACGGCTGGCTCATCGGCCACCCCGAGATGTCGCCCCCCGACTACAGCATGGCCCTGTCCTACAGTCCGGA
R--C--S--H--E--E--N--P--Y--F--H--G--W--L--I--G--H--P--E--M--S--P--P--D--Y--S--M--A--L--S--Y--S--P--E

----------------------------------------------------------------------------------------------------
--Y--A--S--G--A--A--G--L--D--H--S--H--Y--G--G--V--P--P--G--A--G--P--P--G--L--G--G--P--R--P--V--K--R-
GTATGCCAGCGGCGCCGCCGGCCTGGACCACTCCCATTACGGGGGGGTGCCGCCGGGCGCCGGGCCCCCGGGCCTGGGGGGGCCGCGCCCGGTGAAGCGC
:::.::::::::.::::::.::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
GTACGCCAGCGGTGCCGCCAGCCTGGACCACTCCCATTACGGGGGGGTGCCGCCGGGCGCCGGGCCCCCGGGCCTGGGGGGGCCGCGCCCGGTGAAGCGC
--Y--A--S--G--A--A--S--L--D--H--S--H--Y--G--G--V--P--P--G--A--G--P--P--G--L--G--G--P--R--P--V--K--R-

----------------------------------------------------------------------------------------------------
-R--G--T--A--N--R--K--E--R--R--R--T--Q--S--I--N--S--A--F--A--E--L--R--E--C--I--P--N--V--P--A--D--T--
CGAGGCACCGCCAACCGCAAGGAGCGGCGCAGGACTCAGAGCATCAACAGCGCCTTCGCCGAACTGCGCGAGTGCATCCCCAACGTACCCGCCGACACCA
::.::::: :::::::::::::::::::::::::::::::::::::::::::::::::::::.:::::::::::.::::::::.::.:::::::::::::
CGGGGCACAGCCAACCGCAAGGAGCGGCGCAGGACTCAGAGCATCAACAGCGCCTTCGCCGAGCTGCGCGAGTGTATCCCCAATGTGCCCGCCGACACCA
-R--G--T--A--N--R--K--E--R--R--R--T--Q--S--I--N--S--A--F--A--E--L--R--E--C--I--P--N--V--P--A--D--T--

----------------------------------------------------------------------------------------------------
K--L--S--K--I--K--T--L--R--L--A--T--S--Y--I--A--Y--L--M--D--L--L--A--K--D--D--Q--N--G--E--A--E--A--F
AACTCTCCAAAATCAAGACCCTGCGCCTGGCCACCAGCTACATCGCCTACCTCATGGACCTGCTGGCCAAGGACGACCAGAATGGCGAGGCGGAGGCCTT
::::::::::.:::::::: ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::.:::::::::::::::::
AACTCTCCAAGATCAAGACGCTGCGCCTGGCCACCAGCTACATCGCCTACCTCATGGACCTGCTGGCCAAGGACGACCAGAACGGCGAGGCGGAGGCCTT
K--L--S--K--I--K--T--L--R--L--A--T--S--Y--I--A--Y--L--M--D--L--L--A--K--D--D--Q--N--G--E--A--E--A--F

------------------------------------------------------><--------------------------------------------
--K--A--E--I--K--K--T--D--V--K--E--E--K--R--K--K--E--L--N--E--I--L--K--S--T--V--S--S--N--D--K--K--T-
CAAGGCAGAGATCAAGAAGACCGACGTGAAAGAGGAGAAGAGGAAGAAGGAGCTGAACGAAATCTTGAAAAGCACAGTGAGCAGCAACGACAAGAAAACC
.:::::.::.::::::::::: ::.::::::::.:::::.:::::::::::::::                                          :::
TAAGGCGGAAATCAAGAAGACAGATGTGAAAGAAGAGAAAAGGAAGAAGGAGCTG------------------------------------------ACC
--K--A--E--I--K--K--T--D--V--K--E--E--K--R--K--K--E--L--------------------------------------------T-

----------------------------------------------------->
-K--G--R--T--G--W--P--Q--H--V--W--A--L--E--L--K--Q--*-
AAAGGCCGGACGGGCTGGCCGCAGCACGTCTGGGCCCTGGAGCTCAAGCAGTGA
::::::::::::::::::::::::::.:::::::::::::::::::::::::::
AAAGGCCGGACGGGCTGGCCGCAGCATGTCTGGGCCCTGGAGCTCAAGCAGTGA
-K--G--R--T--G--W--P--Q--H--V--W--A--L--E--L--K--Q--*-

Pig Consensus Sequence

>BGISUST0000884948
ATGAGTCTGGTTGGGGGCTTCCCTCACCACCCGGTGGTGCACCATGAGGGCTATCCGTTCGCCGCGGCCGCGGCCGCTGCGGCCGCCGCGGCCGCCAGCC
GCTGCAGCCACGAGGAGAACCCCTACTTCCACGGCTGGCTCATCGGCCACCCCGAGATGTCGCCCCCCGACTACAGCATGGCCCTGTCCTACAGTCCGGA
GTACGCCAGCGGTGCCGCCAGCCTGGACCACTCCCATTACGGGGGGGTGCCGCCGGGCGCCGGGCCCCCGGGCCTGGGGGGGCCGCGCCCGGTGAAGCGC
CGGGGCACAGCCAACCGCAAGGAGCGGCGCAGGACTCAGAGCATCAACAGCGCCTTCGCCGAGCTGCGCGAGTGTATCCCCAATGTGCCCGCCGACACCA
AACTCTCCAAGATCAAGACGCTGCGCCTGGCCACCAGCTACATCGCCTACCTCATGGACCTGCTGGCCAAGGACGACCAGAACGGCGAGGCGGAGGCCTT
TAAGGCGGAAATCAAGAAGACAGATGTGAAAGAAGAGAAAAGGAAGAAGGAGCTG------------------------------------------ACC
AAAGGCCGGACGGGCTGGCCGCAGCATGTCTGGGCCCTGGAGCTCAAGCAGTGA


>BGISUSP0000884948
MSLVGGFPHHPVVHHEGYPFAAAAAAAAAAAASRCSHEENPYFHGWLIGHPEMSPPDYSMALSYSPEYASGAASLDHSHYGGVPPGAGPPGLGGPRPVKR
RGTANRKERRRTQSINSAFAELRECIPNVPADTKLSKIKTLRLATSYIAYLMDLLAKDDQNGEAEAFKAEIKKTDVKEEKRKKEL--------------T
KGRTGWPQHVWALELKQ*