Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000164687 (click for geneview)
Transcript ID ENST00000297258(link to ensembl)
Symbol FABP5
Localtion Chromosome:8:82355326:82359561:1 band: 8q21.13
Description Fatty acid-binding protein, epidermal (E-FABP) (Psoriasis-associated fatty acid-binding protein homolog) (PA-FABP). [Source:Uniprot/SWISSPROT;Acc:Q01469]
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-----------------------------------------------------------------------------><--------------------
-M--A--T--V--Q--Q--L--E--G--R--W--R--L--V--D--S--K--G--F--D--E--Y--M--K--E--L--G--V--G--I--A--L--R--
ATGGCCACAGTTCAGCAGCTGGAAGGAAGATGGCGCCTGGTGGACAGCAAAGGCTTTGATGAATACATGAAGGAGCTAGGAGTGGGAATAGCTTTGCGAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
K--M--G--A--M--A--K--P--D--C--I--I--T--C--D--G--K--N--L--T--I--K--T--E--S--T--L--K--T--T--Q--F--S--C
AAATGGGCGCAATGGCCAAGCCAGATTGTATCATCACTTGTGATGGTAAAAACCTCACCATAAAAACTGAGAGCACTTTGAAAACAACACAGTTTTCTTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------><-----------------------------------------------
--T--L--G--E--K--F--E--E--T--T--A--D--G--R--K--T--Q--T--V--C--N--F--T--D--G--A--L--V--Q--H--Q--E--W-
TACCCTGGGAGAGAAGTTTGAAGAAACCACAGCTGATGGCAGAAAAACTCAGACTGTCTGCAACTTTACAGATGGTGCATTGGTTCAGCATCAGGAGTGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------------><---------------------------------------------
-D--G--K--E--S--T--I--T--R--K--L--K--D--G--K--L--V--V--E--C--V--M--N--N--V--T--C--T--R--I--Y--E--K--
GATGGGAAGGAAAGCACAATAACAAGAAAATTGAAAGATGGGAAATTAGTGGTGGAGTGTGTCATGAACAATGTCACCTGTACTCGGATCTATGAAAAAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------->
V--E--*-
TAGAATAA
        
--------
--------