Sequences
EST Library Info
nco1Newborn 115 days, colon
Clusters
Oligos
SNPs

Gene ID ENSG00000164828 (click for geneview)
Transcript ID ENST00000297445(link to ensembl)
Symbol UNC84A
Localtion Chromosome:7:645403:687780:1 band: 7p22.3
Description Sad1/unc-84 protein-like 1 (Unc-84 homolog A). [Source:Uniprot/SWISSPROT;Acc:O94901]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------><----------------------
-M--D--F--S--R--L--H--M--Y--S--P--P--Q--C--V--P--E--N--T--G--Y--T--Y--A--L--S--S--S--Y--S--S--D--A--
ATGGATTTTTCTCGGCTTCACATGTACAGTCCTCCCCAGTGTGTGCCGGAGAACACGGGCTACACGTATGCGCTCAGTTCCAGCTATTCTTCAGATGCTC
:::::.:::::::::::.:::::::::::.:::::::::::.::::: :::::::: ::::::::::::::.:::                         
ATGGACTTTTCTCGGCTCCACATGTACAGCCCTCCCCAGTGCGTGCCCGAGAACACTGGCTACACGTATGCACTC-------------------------
-M--D--F--S--R--L--H--M--Y--S--P--P--Q--C--V--P--E--N--T--G--Y--T--Y--A--L--------------------------

----------------------------------------------------------------------------------------------------
L--D--F--E--T--E--H--K--L--D--P--V--F--D--S--P--R--M--S--R--R--S--L--R--L--A--T--T--A--C--T--L--G--D
TGGATTTTGAGACGGAGCACAAATTGGACCCTGTATTTGATTCTCCACGGATGTCCCGCCGTAGTTTGCGCCTGGCCACGACAGCATGCACCCTGGGGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------------------------><---------------------------------
--G--E--A--V--G--A--D--S--G--T--S--S--A--V--S--L--K--N--R--A--A--R--T--T--K--Q--R--R--S--T--N--K--S-
TGGTGAGGCTGTGGGTGCCGACAGCGGCACCAGCAGCGCTGTCTCCCTGAAGAACCGAGCGGCCAGAACAACAAAACAGCGCAGAAGCACAAACAAATCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-A--F--S--I--N--H--V--S--R--Q--V--T--S--S--G--V--S--H--G--G--T--V--S--L--Q--D--A--V--T--R--R--P--P--
GCTTTTAGTATCAACCACGTGTCAAGGCAGGTCACGTCCTCTGGCGTCAGCCACGGCGGCACTGTCAGCCTGCAGGATGCTGTGACTCGACGGCCTCCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------><-------------------------><---------------------
V--L--D--E--S--W--I--R--E--Q--T--T--V--D--H--F--W--G--L--D--D--D--G--D--L--K--G--G--N--K--A--A--I--Q
TATTGGACGAGTCTTGGATTCGTGAACAGACCACAGTGGACCACTTCTGGGGTCTTGATGATGATGGTGATCTTAAAGGTGGAAATAAAGCTGCCATTCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--G--N--G--D--V--G--A--A--A--A--T--A--H--N--G--F--S--C--S--N--C--S--M--L--S--E--R--K--D--V--L--T--A-
GGGAAACGGGGATGTGGGAGCCGCCGCCGCCACCGCGCACAACGGCTTCTCCTGCAGCAACTGCAGCATGCTGTCCGAGCGCAAGGACGTGCTCACGGCG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------------><-----------------------------------------
-H--P--A--A--P--G--P--V--S--R--V--Y--S--R--D--R--N--Q--K--C--D--D--C--K--G--K--R--H--L--D--A--H--T--
CACCCCGCGGCCCCCGGGCCCGTGTCGAGAGTTTATTCTAGGGACAGGAATCAAAAATGCGACGACTGTAAGGGCAAGAGGCACCTCGACGCGCACACAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------><------------------------------
A--A--H--S--Q--S--P--R--L--P--G--R--A--G--T--L--W--H--I--W--A--C--A--G--Y--F--L--L--Q--I--L--R--R--I
CCGCCCACTCGCAGTCGCCACGGCTGCCCGGTCGGGCAGGGACCCTCTGGCACATCTGGGCATGTGCAGGTTACTTCTTGCTGCAGATTCTGCGCAGGAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------------><-------------------------------
--G--A--V--G--Q--A--V--S--R--T--A--W--S--A--L--W--L--A--V--V--A--P--G--K--A--A--S--G--V--F--W--W--L-
CGGAGCTGTGGGCCAGGCTGTGTCCAGGACGGCGTGGTCGGCCCTTTGGCTGGCCGTGGTTGCTCCAGGGAAGGCAGCCTCTGGAGTGTTCTGGTGGCTG
                                                                      :::.:::: ::.:.::: .:::::::::: 
----------------------------------------------------------------------AAGACAGCGTCCGAAGTTCTCTGGTGGCTT
-----------------------------------------------------------------------K--T--A--S--E--V--L--W--W--L-

-------------------------------------------------------------><-------------------------------------
-G--I--G--W--Y--Q--F--V--T--L--I--S--W--L--N--V--F--L--L--T--R--C--L--R--N--I--C--K--F--L--V--L--L--
GGGATTGGATGGTACCAGTTTGTTACTTTGATTTCTTGGCTGAATGTGTTTCTTCTTACCAGGTGCCTTCGAAACATCTGCAAGTTTTTAGTCTTGCTCA
:::.::::::::::::::::.::.::::::::::::::::::::.::::::::::::      :::::::::::.::.::::::::::::.:::::::::
GGGGTTGGATGGTACCAGTTCGTCACTTTGATTTCTTGGCTGAACGTGTTTCTTCTT------TGCCTTCGAAATATTTGCAAGTTTTTAATCTTGCTCA
-G--V--G--W--Y--Q--F--V--T--L--I--S--W--L--N--V--F--L--L--------C--L--R--N--I--C--K--F--L--I--L--L--

--------------------><------------------------------------------------------------------------------
I--P--L--F--L--L--L--A--G--L--S--L--R--G--Q--G--N--F--F--S--F--L--P--V--L--N--W--A--S--M--H--R--T--Q
TCCCACTCTTCCTTTTACTAGCAGGTCTCTCCTTACGGGGCCAGGGCAATTTCTTTTCGTTCTTGCCCGTGTTGAACTGGGCAAGCATGCATAGAACACA
:.::.:: :: :::::.                                                                                   
TTCCGCTGTTACTTTTG-----------------------------------------------------------------------------------
I--P--L--L--L--L------------------------------------------------------------------------------------

---------------------------------------------------------------><-----------------------------------
--R--V--D--D--P--Q--D--V--F--K--P--T--T--S--R--L--K--Q--P--L--Q--G--D--S--E--A--F--P--W--H--W--M--S-
GCGGGTGGATGACCCCCAGGACGTGTTTAAACCCACGACTTCTCGCCTGAAGCAGCCTCTGCAGGGTGACAGTGAGGCTTTTCCGTGGCATTGGATGAGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-G--V--E--Q--Q--V--A--S--L--S--G--Q--C--H--H--H--G--E--N--L--R--E--L--T--T--L--L--Q--K--L--Q--A--R--
GGCGTGGAGCAGCAGGTGGCCTCTCTGTCTGGACAGTGCCACCACCATGGTGAGAATCTCCGAGAGCTGACCACTTTGCTACAGAAGCTGCAGGCTCGGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------------------><-------------------------
V--D--Q--M--E--G--G--A--A--G--P--S--A--S--V--R--D--A--V--G--Q--P--P--R--E--T--D--F--M--A--F--H--Q--E
TGGACCAGATGGAAGGCGGCGCTGCCGGGCCGTCAGCTTCGGTCAGAGACGCTGTGGGACAGCCCCCGAGGGAGACTGACTTTATGGCCTTTCACCAAGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------><--------------------------------------
--H--E--V--R--M--S--H--L--E--D--I--L--G--K--L--R--E--K--S--E--A--I--Q--K--E--L--E--Q--T--K--Q--K--T-
ACATGAAGTGCGTATGTCACACTTGGAAGATATTCTGGGAAAACTGAGAGAAAAATCTGAGGCCATCCAGAAGGAACTAGAACAGACCAAGCAAAAAACA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----><----------------------------------------------------------------------------------------------
-I--S--A--V--G--E--Q--L--L--P--T--V--E--H--L--Q--L--E--L--D--Q--L--K--S--E--L--S--S--W--R--H--V--K--
ATCAGTGCGGTTGGTGAGCAGCTCCTGCCCACAGTCGAGCACCTCCAGCTGGAGCTGGATCAGCTAAAGTCAGAGCTGTCCAGCTGGCGACACGTGAAGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------><----------------------------------------------------------------
T--G--C--E--T--V--D--A--V--Q--E--R--V--D--V--Q--V--R--E--M--V--K--L--L--F--S--E--D--Q--Q--G--G--S--L
CCGGCTGTGAGACAGTGGATGCCGTACAAGAAAGAGTGGACGTGCAAGTCAGAGAAATGGTGAAACTCCTGTTTTCCGAAGATCAGCAAGGCGGTTCTCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--E--Q--L--L--Q--R--F--S--S--Q--F--V--S--K--G--D--L--Q--T--M--L--R--D--L--Q--L--Q--I--L--R--N--V--T-
GGAACAGCTGCTGCAGAGGTTCTCATCACAGTTTGTGAGCAAAGGCGACTTGCAGACGATGCTGCGAGACCTGCAGCTGCAGATCCTGCGGAACGTCACC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------------------------------------------------><---------
-H--H--V--S--V--T--K--Q--L--P--T--S--E--A--V--V--S--A--V--S--E--A--G--A--S--G--I--T--E--A--Q--A--R--
CACCACGTTTCCGTGACCAAGCAGCTCCCAACCTCAGAAGCCGTGGTGTCTGCTGTGAGCGAGGCGGGGGCGTCTGGAATAACAGAGGCGCAAGCACGTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------><------------------------
A--I--V--N--S--A--L--K--L--Y--S--Q--D--K--T--G--M--V--D--F--A--L--E--S--G--G--G--S--I--L--S--T--R--C
CCATCGTGAACAGCGCCTTGAAGCTGTATTCCCAAGATAAGACCGGGATGGTGGACTTTGCTCTGGAATCTGGTGGTGGCAGCATCTTGAGTACTCGCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------------------------------------><--------
--S--E--T--Y--E--T--K--T--A--L--M--S--L--F--G--I--P--L--W--Y--F--S--Q--S--P--R--V--V--I--Q--P--D--I-
TTCTGAAACTTACGAAACCAAAACGGCGCTGATGAGTCTGTTTGGGATCCCGCTGTGGTACTTCTCGCAGTCCCCGCGCGTGGTCATCCAGCCTGACATT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-Y--P--G--N--C--W--A--F--K--G--S--Q--G--Y--L--V--V--R--L--S--M--M--I--H--P--A--A--F--T--L--E--H--I--
TACCCCGGTAACTGCTGGGCATTTAAAGGCTCCCAGGGGTACCTGGTGGTGAGGCTCTCCATGATGATCCACCCAGCCGCCTTCACTCTGGAGCACATCC
                                                                              :::::::: :::::::::::::
------------------------------------------------------------------------------GCCTTCACGCTGGAGCACATCC
-------------------------------------------------------------------------------A--F--T--L--E--H--I--

----------------------------------------------------------><----------------------------------------
P--K--T--L--S--P--T--G--N--I--S--S--A--P--K--D--F--A--V--Y--G--L--E--N--E--Y--Q--E--E--G--Q--L--L--G
CTAAGACGCTGTCGCCAACAGGCAACATCAGCAGCGCCCCCAAGGACTTCGCCGTCTATGGATTAGAAAATGAGTATCAGGAAGAAGGGCAGCTTCTGGG
:.:::::::::::::: ::.:::::::::: ::::::::: :::::::::::::::   ::::::::..:.:::::.:::::::::::::::::.:::::
CCAAGACGCTGTCGCCCACGGGCAACATCACCAGCGCCCCGAAGGACTTCGCCGTC---GGATTAGAGGACGAGTACCAGGAAGAAGGGCAGCTCCTGGG
P--K--T--L--S--P--T--G--N--I--T--S--A--P--K--D--F--A--V-----G--L--E--D--E--Y--Q--E--E--G--Q--L--L--G

---------------------------------------------------><-----------------------------------------------
--Q--F--T--Y--D--Q--D--G--E--S--L--Q--M--F--Q--A--L--K--R--P--D--D--T--A--F--Q--I--V--E--L--R--I--F-
ACAGTTCACGTATGATCAGGATGGGGAGTCGCTCCAGATGTTCCAGGCCCTGAAAAGACCCGACGACACAGCTTTCCAAATAGTGGAACTTCGGATTTTT
::.:::::: :::::.::::: ::::::::::::::::::::::: :.::::::::::::.   :: :  ::::::::.::::::::.:: :::::::::
ACGGTTCACCTATGACCAGGAAGGGGAGTCGCTCCAGATGTTCCACGTCCTGAAAAGACCT---GAAAGCGCTTTCCAGATAGTGGAGCTGCGGATTTTT
--R--F--T--Y--D--Q--E--G--E--S--L--Q--M--F--H--V--L--K--R--P-----E--S--A--F--Q--I--V--E--L--R--I--F-

-------------------------------------------------------------------->
-S--N--W--G--H--P--E--Y--T--C--L--Y--R--F--R--V--H--G--E--P--V--K--*-
TCTAACTGGGGCCATCCTGAGTATACCTGTCTGTATCGGTTCAGAGTTCATGGCGAACCTGTCAAGTGA
:::::::::::::::::.::.::.:: ::::::::.::::::::::::::.:: :::::..::::::.:
TCTAACTGGGGCCATCCCGAATACACGTGTCTGTACCGGTTCAGAGTTCACGGAGAACCCATCAAGTAA
-S--N--W--G--H--P--E--Y--T--C--L--Y--R--F--R--V--H--G--E--P--I--K--*-

Pig Consensus Sequence

>BGISUST0000900432
ATGGACTTTTCTCGGCTCCACATGTACAGCCCTCCCCAGTGCGTGCCCGAGAACACTGGCTACACGTATGCACTC-------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------AAGACAGCGTCCGAAGTTCTCTGGTGGCTT
GGGGTTGGATGGTACCAGTTCGTCACTTTGATTTCTTGGCTGAACGTGTTTCTTCTT------TGCCTTCGAAATATTTGCAAGTTTTTAATCTTGCTCA
TTCCGCTGTTACTTTTG-----------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
------------------------------------------------------------------------------GCCTTCACGCTGGAGCACATCC
CCAAGACGCTGTCGCCCACGGGCAACATCACCAGCGCCCCGAAGGACTTCGCCGTC---GGATTAGAGGACGAGTACCAGGAAGAAGGGCAGCTCCTGGG
ACGGTTCACCTATGACCAGGAAGGGGAGTCGCTCCAGATGTTCCACGTCCTGAAAAGACCTGAAAGCGCTTTCCAGATAGTGGAGCTGCGGATTTTTTCT
AACTGGGGCCATCCCGAATACACGTGTCTGTACCGGTTCAGAGTTCACGGAGAACCCATCAAGTAA


>BGISUSP0000900432
MDFSRLHMYSPPQCVPENTGYTYAL---------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
------------------------------------------------------------------------------------------KTASEVLWWL
GVGWYQFVTLISWLNVFLL--CLRNICKFLILLIPLLLL-------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
--------------------------AFTLEHIPKTLSPTGNITSAPKDFAV-GLEDEYQEEGQLLGRFTYDQEGESLQMFHVLKRPESAFQIVELRIFS
NWGHPEYTCLYRFRVHGEPIK*